\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217737734:

Variant ID: vg0217737734 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17737734
Reference Allele: GAlternative Allele: A,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 39. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGTAATGGAAGGTGACCGAATGGCATAAATCTAAAGTGTGGAAACTTTCAGTAGTATACCCTAAACTTATCACTAGTGCAGAACTGATCTTTTACAGT[G/A,C]
GTACCCAAAATAAAAATATTTCGGTTAGATTATTAGTACCGGTTCTAAAAGTCCGAGTACTAAAAAATGCATCTTTAATACCGGTTGGTAACACCAACCG

Reverse complement sequence

CGGTTGGTGTTACCAACCGGTATTAAAGATGCATTTTTTAGTACTCGGACTTTTAGAACCGGTACTAATAATCTAACCGAAATATTTTTATTTTGGGTAC[C/T,G]
ACTGTAAAAGATCAGTTCTGCACTAGTGATAAGTTTAGGGTATACTACTGAAAGTTTCCACACTTTAGATTTATGCCATTCGGTCACCTTCCATTACTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.10% 22.30% 1.65% 26.87% C: 0.11%
All Indica  2759 24.40% 37.40% 2.54% 35.45% C: 0.18%
All Japonica  1512 98.60% 0.50% 0.20% 0.66% NA
Aus  269 25.30% 0.40% 0.37% 73.98% NA
Indica I  595 46.40% 28.70% 2.86% 22.02% NA
Indica II  465 27.30% 44.70% 3.01% 24.95% NA
Indica III  913 10.60% 37.60% 1.75% 49.73% C: 0.33%
Indica Intermediate  786 22.10% 39.40% 2.93% 35.24% C: 0.25%
Temperate Japonica  767 98.80% 0.80% 0.26% 0.13% NA
Tropical Japonica  504 98.40% 0.20% 0.20% 1.19% NA
Japonica Intermediate  241 98.30% 0.40% 0.00% 1.24% NA
VI/Aromatic  96 30.20% 1.00% 1.04% 67.71% NA
Intermediate  90 64.40% 12.20% 3.33% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217737734 G -> A LOC_Os02g29820.1 downstream_gene_variant ; 2677.0bp to feature; MODIFIER silent_mutation Average:38.42; most accessible tissue: Callus, score: 70.187 N N N N
vg0217737734 G -> A LOC_Os02g29830.1 downstream_gene_variant ; 4286.0bp to feature; MODIFIER silent_mutation Average:38.42; most accessible tissue: Callus, score: 70.187 N N N N
vg0217737734 G -> A LOC_Os02g29800-LOC_Os02g29820 intergenic_region ; MODIFIER silent_mutation Average:38.42; most accessible tissue: Callus, score: 70.187 N N N N
vg0217737734 G -> DEL N N silent_mutation Average:38.42; most accessible tissue: Callus, score: 70.187 N N N N
vg0217737734 G -> C LOC_Os02g29820.1 downstream_gene_variant ; 2677.0bp to feature; MODIFIER silent_mutation Average:38.42; most accessible tissue: Callus, score: 70.187 N N N N
vg0217737734 G -> C LOC_Os02g29830.1 downstream_gene_variant ; 4286.0bp to feature; MODIFIER silent_mutation Average:38.42; most accessible tissue: Callus, score: 70.187 N N N N
vg0217737734 G -> C LOC_Os02g29800-LOC_Os02g29820 intergenic_region ; MODIFIER silent_mutation Average:38.42; most accessible tissue: Callus, score: 70.187 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217737734 2.91E-07 1.55E-10 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 8.87E-07 6.71E-11 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 NA 8.48E-10 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 1.47E-06 4.79E-36 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 2.39E-06 3.91E-12 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 3.90E-06 4.52E-09 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 NA 1.32E-24 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 NA 1.39E-08 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 4.03E-06 3.32E-21 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 NA 4.24E-08 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 4.80E-07 6.87E-35 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 1.12E-06 1.54E-12 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 4.59E-06 1.97E-10 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 2.26E-07 8.71E-37 mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 1.07E-08 9.42E-13 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 2.37E-07 1.00E-11 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 3.03E-06 4.17E-11 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 5.24E-07 5.19E-12 mr1093_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 NA 1.75E-55 mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 2.58E-07 4.82E-14 mr1109_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 6.34E-07 9.34E-41 mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 1.39E-08 1.38E-14 mr1129_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 NA 3.71E-10 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 4.84E-06 2.07E-09 mr1243_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 NA 3.32E-07 mr1248_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 5.49E-07 1.77E-11 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 NA 2.06E-07 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 1.17E-06 4.39E-26 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 3.53E-07 7.82E-11 mr1255_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 2.30E-07 4.97E-42 mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 1.35E-08 1.51E-15 mr1257_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 NA 4.29E-12 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 NA 1.23E-10 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 2.43E-06 1.79E-09 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 6.87E-07 2.47E-11 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 1.07E-06 NA mr1599_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 1.61E-08 2.08E-13 mr1599_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737734 NA 1.15E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251