\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217737425:

Variant ID: vg0217737425 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17737425
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.86, C: 0.14, others allele: 0.00, population size: 43. )

Flanking Sequence (100 bp) in Reference Genome:


CGTGTGCACGTATGCATGCATGTTTTTTTATCTCGACGCTTTTAGCTTGAGAGTTCAATGTGAGTCTTTCTAACTTATATAGTACTTGTATATTTTTAAT[A/C]
TTGGATGATATATTTCAAACCATGTATTGTTTTTAAGATCCGTTTTAACCATTGAATCCCACTTAAAATATATGATAAAATGAGTATACTATTGAATACA

Reverse complement sequence

TGTATTCAATAGTATACTCATTTTATCATATATTTTAAGTGGGATTCAATGGTTAAAACGGATCTTAAAAACAATACATGGTTTGAAATATATCATCCAA[T/G]
ATTAAAAATATACAAGTACTATATAAGTTAGAAAGACTCACATTGAACTCTCAAGCTAAAAGCGTCGAGATAAAAAAACATGCATGCATACGTGCACACG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.80% 23.40% 1.25% 26.58% NA
All Indica  2759 24.10% 38.90% 1.96% 34.98% NA
All Japonica  1512 98.60% 0.70% 0.00% 0.66% NA
Aus  269 24.90% 0.70% 0.74% 73.61% NA
Indica I  595 46.10% 30.10% 2.18% 21.68% NA
Indica II  465 27.10% 47.30% 1.08% 24.52% NA
Indica III  913 10.40% 38.30% 2.30% 48.96% NA
Indica Intermediate  786 21.80% 41.30% 1.91% 34.99% NA
Temperate Japonica  767 98.80% 1.00% 0.00% 0.13% NA
Tropical Japonica  504 98.40% 0.40% 0.00% 1.19% NA
Japonica Intermediate  241 98.30% 0.40% 0.00% 1.24% NA
VI/Aromatic  96 29.20% 1.00% 2.08% 67.71% NA
Intermediate  90 61.10% 17.80% 1.11% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217737425 A -> DEL N N silent_mutation Average:44.03; most accessible tissue: Callus, score: 91.423 N N N N
vg0217737425 A -> C LOC_Os02g29800.1 downstream_gene_variant ; 4983.0bp to feature; MODIFIER silent_mutation Average:44.03; most accessible tissue: Callus, score: 91.423 N N N N
vg0217737425 A -> C LOC_Os02g29820.1 downstream_gene_variant ; 2986.0bp to feature; MODIFIER silent_mutation Average:44.03; most accessible tissue: Callus, score: 91.423 N N N N
vg0217737425 A -> C LOC_Os02g29830.1 downstream_gene_variant ; 4595.0bp to feature; MODIFIER silent_mutation Average:44.03; most accessible tissue: Callus, score: 91.423 N N N N
vg0217737425 A -> C LOC_Os02g29800-LOC_Os02g29820 intergenic_region ; MODIFIER silent_mutation Average:44.03; most accessible tissue: Callus, score: 91.423 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217737425 5.22E-08 1.82E-11 mr1089 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 2.90E-06 NA mr1093 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 1.12E-08 5.51E-13 mr1093 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 NA 8.71E-06 mr1106 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 8.74E-06 3.45E-12 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 3.46E-07 3.61E-37 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 1.94E-07 2.58E-14 mr1129 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 3.16E-07 3.79E-10 mr1235 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 NA 3.63E-06 mr1243 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 NA 1.09E-25 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 3.83E-06 4.19E-10 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 NA 7.04E-06 mr1253 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 3.87E-08 1.18E-23 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 2.63E-07 5.09E-10 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 1.18E-08 1.49E-36 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 1.47E-08 1.12E-14 mr1257 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 1.10E-07 2.79E-12 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 1.37E-08 9.90E-38 mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 7.47E-10 1.24E-14 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 2.15E-06 NA mr1599 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 5.07E-10 5.08E-15 mr1599 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 NA 2.57E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 NA 6.20E-11 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 9.87E-06 4.18E-11 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 8.72E-06 3.18E-14 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 5.31E-06 3.54E-39 mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 4.70E-07 3.00E-14 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 NA 6.91E-10 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 NA 8.81E-09 mr1243_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 NA 9.45E-07 mr1248_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 5.56E-06 6.04E-11 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 NA 2.46E-07 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 NA 5.06E-25 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 NA 3.20E-10 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 1.62E-06 8.93E-41 mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 3.04E-07 4.55E-15 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 NA 1.43E-11 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 NA 1.52E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 8.29E-06 2.24E-09 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 6.79E-06 8.19E-11 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 1.82E-06 NA mr1599_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217737425 1.45E-07 1.09E-13 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251