Search for Variation information by Variation ID:
Detailed information for vg0217709534:
| Variant ID: vg0217709534 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 17709534 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
ACTAGGTTGATTTTGTCTCCAGAACAAGCAATTTTTGAGAAGCCAGAGGGGACAGAAAATCGGCATCTCAAGCCATTGTATGTTAATGGGTTCGTCAATG[C/G]
GAAGCTGATGTTCAAGATGATGGTTGATGGTGGGGTTGCTGTGAATTTAATGCCATATACTACATTCAGAAAGTTGGGCAGGAATGCAGATGATCTCATC
Reverse complement sequence
GATGAGATCATCTGCATTCCTGCCCAACTTTCTGAATGTAGTATATGGCATTAAATTCACAGCAACCCCACCATCAACCATCATCTTGAACATCAGCTTC[G/C]
CATTGACGAACCCATTAACATACAATGGCTTGAGATGCCGATTTTCTGTCCCCTCTGGCTTCTCAAAAATTGCTTGTTCTGGAGACAAAATCAACCTAGT
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.80% | 38.30% | 1.40% | 8.46% | NA |
| All Indica | 2759 | 29.00% | 63.40% | 2.10% | 5.58% | NA |
| All Japonica | 1512 | 98.70% | 0.70% | 0.26% | 0.40% | NA |
| Aus | 269 | 25.70% | 11.50% | 0.74% | 62.08% | NA |
| Indica I | 595 | 51.40% | 43.40% | 2.35% | 2.86% | NA |
| Indica II | 465 | 34.40% | 59.80% | 1.94% | 3.87% | NA |
| Indica III | 913 | 11.30% | 79.20% | 1.75% | 7.78% | NA |
| Indica Intermediate | 786 | 29.30% | 62.20% | 2.42% | 6.11% | NA |
| Temperate Japonica | 767 | 99.00% | 0.80% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 0.80% | 0.40% | 0.40% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 28.10% | 3.10% | 1.04% | 67.71% | NA |
| Intermediate | 90 | 67.80% | 22.20% | 1.11% | 8.89% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0217709534 | C -> G | LOC_Os02g29760.1 | missense_variant ; p.Ala588Gly; MODERATE | nonsynonymous_codon ; A588G | Average:31.096; most accessible tissue: Zhenshan97 young leaf, score: 70.177 | possibly damaging  |
-1.769 |
TOLERATED | 1.00 |
| vg0217709534 | C -> DEL | LOC_Os02g29760.1 | N | frameshift_variant | Average:31.096; most accessible tissue: Zhenshan97 young leaf, score: 70.177 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0217709534 | 2.68E-06 | 5.42E-09 | mr1093_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217709534 | NA | 2.37E-11 | mr1138_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217709534 | NA | 1.02E-07 | mr1243_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217709534 | NA | 1.75E-33 | mr1257_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217709534 | 8.08E-06 | NA | mr1599_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |