\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217677605:

Variant ID: vg0217677605 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17677605
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, C: 0.01, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


TCAAACAGCTATAGCGGGAGATTTAAAACCCTGCCTGCAGGTCGGCGGCCGCCATCGCCGGGAAGAAGTCGGAGGCGTTGGGCGTCGCGGCTAGCTTGGT[G/C]
GCCTCCTGGACGGCGTCCCTCAGGTCGGGTCGACGAGGTCGGCGGAGAACGCGGTGCACGACAGGATGCCCAGGAATGCCTCGAACGCCTCGAGCCCGAC

Reverse complement sequence

GTCGGGCTCGAGGCGTTCGAGGCATTCCTGGGCATCCTGTCGTGCACCGCGTTCTCCGCCGACCTCGTCGACCCGACCTGAGGGACGCCGTCCAGGAGGC[C/G]
ACCAAGCTAGCCGCGACGCCCAACGCCTCCGACTTCTTCCCGGCGATGGCGGCCGCCGACCTGCAGGCAGGGTTTTAAATCTCCCGCTATAGCTGTTTGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.70% 23.40% 1.29% 26.60% NA
All Indica  2759 23.80% 39.20% 2.10% 34.90% NA
All Japonica  1512 98.60% 0.70% 0.00% 0.73% NA
Aus  269 25.30% 0.00% 1.12% 73.61% NA
Indica I  595 45.50% 31.40% 2.35% 20.67% NA
Indica II  465 26.50% 47.50% 1.08% 24.95% NA
Indica III  913 10.40% 37.10% 2.19% 50.27% NA
Indica Intermediate  786 21.20% 42.60% 2.42% 33.72% NA
Temperate Japonica  767 98.80% 1.00% 0.00% 0.13% NA
Tropical Japonica  504 98.40% 0.20% 0.00% 1.39% NA
Japonica Intermediate  241 98.30% 0.40% 0.00% 1.24% NA
VI/Aromatic  96 28.10% 2.10% 0.00% 69.79% NA
Intermediate  90 64.40% 15.60% 0.00% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217677605 G -> DEL N N silent_mutation Average:62.288; most accessible tissue: Minghui63 young leaf, score: 88.24 N N N N
vg0217677605 G -> C LOC_Os02g29700.1 upstream_gene_variant ; 4643.0bp to feature; MODIFIER silent_mutation Average:62.288; most accessible tissue: Minghui63 young leaf, score: 88.24 N N N N
vg0217677605 G -> C LOC_Os02g29710.1 upstream_gene_variant ; 2413.0bp to feature; MODIFIER silent_mutation Average:62.288; most accessible tissue: Minghui63 young leaf, score: 88.24 N N N N
vg0217677605 G -> C LOC_Os02g29730.1 upstream_gene_variant ; 2173.0bp to feature; MODIFIER silent_mutation Average:62.288; most accessible tissue: Minghui63 young leaf, score: 88.24 N N N N
vg0217677605 G -> C LOC_Os02g29720.1 intron_variant ; MODIFIER silent_mutation Average:62.288; most accessible tissue: Minghui63 young leaf, score: 88.24 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0217677605 G C -0.02 -0.02 -0.02 -0.02 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217677605 2.64E-06 NA mr1089 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 1.38E-08 6.33E-12 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 7.06E-06 NA mr1093 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 3.03E-06 1.03E-11 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 1.82E-06 NA mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 2.76E-06 2.10E-12 mr1109 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 9.25E-06 NA mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 NA 3.20E-10 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 NA 7.26E-08 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 NA 1.74E-07 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 2.24E-06 1.46E-26 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 2.85E-07 2.09E-11 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 NA 5.94E-06 mr1253 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 6.12E-06 2.20E-21 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 5.12E-06 2.97E-09 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 7.76E-06 3.28E-32 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 1.07E-06 1.13E-12 mr1257 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 NA 4.08E-09 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 1.48E-06 4.57E-10 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 2.50E-06 NA mr1599 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 5.79E-07 2.95E-10 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 NA 5.49E-08 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 NA 3.41E-11 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 NA 4.79E-12 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 NA 6.65E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 NA 1.34E-09 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 NA 7.87E-09 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 NA 5.68E-20 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 NA 5.60E-09 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 NA 1.76E-34 mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 NA 8.05E-12 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 NA 5.16E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677605 NA 1.02E-08 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251