\
| Variant ID: vg0217677243 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 17677243 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, A: 0.14, others allele: 0.00, population size: 80. )
AATTTAAGATTCAAGAATTAATCATACCGCGATGAGTCCCTTGATGTTATTACGGTCAATCACAGGATTGTTGTTCTTCCATTCGTCTTCGTTATCGAGC[G/A]
CCACGTCCAGCATGTCATCCTTCCGCGGCTCGCCGGCTTCACGGCCACCCTTCCGCCGAGCAAGAAGCTCGTCGATGATCCCATAGGCACGCGCTACTAG
CTAGTAGCGCGTGCCTATGGGATCATCGACGAGCTTCTTGCTCGGCGGAAGGGTGGCCGTGAAGCCGGCGAGCCGCGGAAGGATGACATGCTGGACGTGG[C/T]
GCTCGATAACGAAGACGAATGGAAGAACAACAATCCTGTGATTGACCGTAATAACATCAAGGGACTCATCGCGGTATGATTAATTCTTGAATCTTAAATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.90% | 23.30% | 1.10% | 26.70% | NA |
| All Indica | 2759 | 24.10% | 39.10% | 1.74% | 35.12% | NA |
| All Japonica | 1512 | 98.60% | 0.70% | 0.00% | 0.73% | NA |
| Aus | 269 | 25.30% | 0.00% | 1.49% | 73.23% | NA |
| Indica I | 595 | 45.50% | 31.60% | 2.02% | 20.84% | NA |
| Indica II | 465 | 26.50% | 47.10% | 1.08% | 25.38% | NA |
| Indica III | 913 | 11.20% | 36.80% | 1.75% | 50.27% | NA |
| Indica Intermediate | 786 | 21.40% | 42.60% | 1.91% | 34.10% | NA |
| Temperate Japonica | 767 | 98.80% | 1.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 98.40% | 0.20% | 0.00% | 1.39% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.40% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 28.10% | 2.10% | 0.00% | 69.79% | NA |
| Intermediate | 90 | 65.60% | 14.40% | 0.00% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0217677243 | G -> A | LOC_Os02g29720.1 | missense_variant ; p.Ala196Val; MODERATE | nonsynonymous_codon ; A196V | Average:48.239; most accessible tissue: Minghui63 flag leaf, score: 82.521 | unknown | unknown | TOLERATED | 0.23 |
| vg0217677243 | G -> DEL | LOC_Os02g29720.1 | N | frameshift_variant | Average:48.239; most accessible tissue: Minghui63 flag leaf, score: 82.521 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0217677243 | 5.43E-06 | NA | mr1089 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | 4.66E-07 | 3.82E-10 | mr1089 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | NA | 1.64E-09 | mr1093 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | 4.62E-06 | NA | mr1109 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | NA | 2.36E-11 | mr1109 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | NA | 1.37E-08 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | NA | 1.03E-06 | mr1235 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | NA | 8.98E-07 | mr1236 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | 1.36E-06 | 3.02E-27 | mr1251 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | 3.58E-08 | 6.15E-12 | mr1251 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | NA | 4.92E-20 | mr1255 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | NA | 8.76E-08 | mr1255 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | 7.66E-06 | 1.22E-32 | mr1257 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | 3.38E-06 | 8.95E-12 | mr1257 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | 2.03E-06 | 1.01E-10 | mr1423 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | NA | 2.84E-09 | mr1435 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | 2.79E-08 | NA | mr1599 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | 5.63E-08 | 4.73E-12 | mr1599 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | NA | 1.98E-10 | mr1089_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | NA | 2.00E-08 | mr1093_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | 5.17E-06 | NA | mr1109_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | NA | 3.89E-14 | mr1109_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | NA | 2.95E-12 | mr1129_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | NA | 1.53E-10 | mr1235_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | NA | 9.08E-06 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | NA | 7.07E-07 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | NA | 1.66E-06 | mr1243_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | 9.34E-06 | 4.25E-13 | mr1251_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | NA | 8.55E-24 | mr1255_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | 2.12E-06 | 1.72E-11 | mr1255_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | NA | 8.45E-37 | mr1257_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | NA | 2.20E-13 | mr1257_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | NA | 8.85E-07 | mr1423_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | NA | 5.97E-13 | mr1435_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217677243 | NA | 1.49E-11 | mr1599_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |