Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217677243:

Variant ID: vg0217677243 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17677243
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, A: 0.14, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


AATTTAAGATTCAAGAATTAATCATACCGCGATGAGTCCCTTGATGTTATTACGGTCAATCACAGGATTGTTGTTCTTCCATTCGTCTTCGTTATCGAGC[G/A]
CCACGTCCAGCATGTCATCCTTCCGCGGCTCGCCGGCTTCACGGCCACCCTTCCGCCGAGCAAGAAGCTCGTCGATGATCCCATAGGCACGCGCTACTAG

Reverse complement sequence

CTAGTAGCGCGTGCCTATGGGATCATCGACGAGCTTCTTGCTCGGCGGAAGGGTGGCCGTGAAGCCGGCGAGCCGCGGAAGGATGACATGCTGGACGTGG[C/T]
GCTCGATAACGAAGACGAATGGAAGAACAACAATCCTGTGATTGACCGTAATAACATCAAGGGACTCATCGCGGTATGATTAATTCTTGAATCTTAAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.90% 23.30% 1.10% 26.70% NA
All Indica  2759 24.10% 39.10% 1.74% 35.12% NA
All Japonica  1512 98.60% 0.70% 0.00% 0.73% NA
Aus  269 25.30% 0.00% 1.49% 73.23% NA
Indica I  595 45.50% 31.60% 2.02% 20.84% NA
Indica II  465 26.50% 47.10% 1.08% 25.38% NA
Indica III  913 11.20% 36.80% 1.75% 50.27% NA
Indica Intermediate  786 21.40% 42.60% 1.91% 34.10% NA
Temperate Japonica  767 98.80% 1.00% 0.00% 0.13% NA
Tropical Japonica  504 98.40% 0.20% 0.00% 1.39% NA
Japonica Intermediate  241 98.30% 0.40% 0.00% 1.24% NA
VI/Aromatic  96 28.10% 2.10% 0.00% 69.79% NA
Intermediate  90 65.60% 14.40% 0.00% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217677243 G -> A LOC_Os02g29720.1 missense_variant ; p.Ala196Val; MODERATE nonsynonymous_codon ; A196V Average:48.239; most accessible tissue: Minghui63 flag leaf, score: 82.521 unknown unknown TOLERATED 0.23
vg0217677243 G -> DEL LOC_Os02g29720.1 N frameshift_variant Average:48.239; most accessible tissue: Minghui63 flag leaf, score: 82.521 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217677243 5.43E-06 NA mr1089 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 4.66E-07 3.82E-10 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 NA 1.64E-09 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 4.62E-06 NA mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 NA 2.36E-11 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 NA 1.37E-08 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 NA 1.03E-06 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 NA 8.98E-07 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 1.36E-06 3.02E-27 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 3.58E-08 6.15E-12 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 NA 4.92E-20 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 NA 8.76E-08 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 7.66E-06 1.22E-32 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 3.38E-06 8.95E-12 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 2.03E-06 1.01E-10 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 NA 2.84E-09 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 2.79E-08 NA mr1599 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 5.63E-08 4.73E-12 mr1599 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 NA 1.98E-10 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 NA 2.00E-08 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 5.17E-06 NA mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 NA 3.89E-14 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 NA 2.95E-12 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 NA 1.53E-10 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 NA 9.08E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 NA 7.07E-07 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 NA 1.66E-06 mr1243_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 9.34E-06 4.25E-13 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 NA 8.55E-24 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 2.12E-06 1.72E-11 mr1255_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 NA 8.45E-37 mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 NA 2.20E-13 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 NA 8.85E-07 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 NA 5.97E-13 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217677243 NA 1.49E-11 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251