\
| Variant ID: vg0217651623 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 17651623 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 116. )
TATCATTTATAGATTTAACTGCGATTTATTTATCAAATCAACTGGCACGCTCATACATTCGAAGGCGAGCTTTGGACCTGCACTGGAGTTAAGCAGATCT[C/T]
CCAGGCCTTGTGTTTTCTGTCAACACGCTTTTGGCACACCTGGTGGGACATTTAAGAAGTCAGCCAACAATTCTTCCTCATGGCCGAGAAACCACCACCA
TGGTGGTGGTTTCTCGGCCATGAGGAAGAATTGTTGGCTGACTTCTTAAATGTCCCACCAGGTGTGCCAAAAGCGTGTTGACAGAAAACACAAGGCCTGG[G/A]
AGATCTGCTTAACTCCAGTGCAGGTCCAAAGCTCGCCTTCGAATGTATGAGCGTGCCAGTTGATTTGATAAATAAATCGCAGTTAAATCTATAAATGATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.90% | 27.50% | 3.79% | 0.78% | NA |
| All Indica | 2759 | 47.50% | 45.80% | 5.76% | 0.91% | NA |
| All Japonica | 1512 | 98.70% | 0.70% | 0.46% | 0.20% | NA |
| Aus | 269 | 97.80% | 1.50% | 0.74% | 0.00% | NA |
| Indica I | 595 | 38.50% | 52.10% | 7.73% | 1.68% | NA |
| Indica II | 465 | 23.40% | 67.70% | 7.53% | 1.29% | NA |
| Indica III | 913 | 68.70% | 28.60% | 2.63% | 0.11% | NA |
| Indica Intermediate | 786 | 44.00% | 48.10% | 6.87% | 1.02% | NA |
| Temperate Japonica | 767 | 98.80% | 0.70% | 0.39% | 0.13% | NA |
| Tropical Japonica | 504 | 98.60% | 0.40% | 0.79% | 0.20% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.20% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 85.40% | 4.20% | 4.17% | 6.25% | NA |
| Intermediate | 90 | 68.90% | 20.00% | 7.78% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0217651623 | C -> T | LOC_Os02g29650.1 | upstream_gene_variant ; 80.0bp to feature; MODIFIER | silent_mutation | Average:27.654; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0217651623 | C -> T | LOC_Os02g29640-LOC_Os02g29650 | intergenic_region ; MODIFIER | silent_mutation | Average:27.654; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0217651623 | C -> DEL | N | N | silent_mutation | Average:27.654; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0217651623 | NA | 1.04E-14 | mr1013 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217651623 | NA | 1.43E-09 | mr1013 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217651623 | NA | 3.73E-09 | mr1014 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217651623 | 3.67E-06 | 8.94E-11 | mr1015 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217651623 | NA | 4.72E-15 | mr1031 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217651623 | NA | 2.86E-09 | mr1031 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217651623 | NA | 8.29E-14 | mr1034 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217651623 | NA | 2.89E-09 | mr1034 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217651623 | NA | 2.87E-14 | mr1056 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217651623 | NA | 3.51E-08 | mr1056 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217651623 | NA | 3.81E-06 | mr1268 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217651623 | NA | 6.91E-06 | mr1677 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217651623 | NA | 3.72E-10 | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217651623 | NA | 1.10E-09 | mr1319_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217651623 | NA | 7.40E-07 | mr1428_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |