Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217639783:

Variant ID: vg0217639783 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17639783
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.09, G: 0.01, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


TTGATTTTTCCCTTCTAGTTTTGGGTTTTATTTTATTTTTTCTTCCGAATTTTAAGATTCTTATACGTACTCTTCCTCCAATATTGCCTATTGTTAATCC[C/T]
GAATTTTTGTTATTTCTAAACTGTGTTTCTATATAGACTCTCTTTTTCTTTTTCTTCAATTAATGTTGGAATTTCTAGCATCCTCAAATTTGCCTATTGT

Reverse complement sequence

ACAATAGGCAAATTTGAGGATGCTAGAAATTCCAACATTAATTGAAGAAAAAGAAAAAGAGAGTCTATATAGAAACACAGTTTAGAAATAACAAAAATTC[G/A]
GGATTAACAATAGGCAATATTGGAGGAAGAGTACGTATAAGAATCTTAAAATTCGGAAGAAAAAATAAAATAAAACCCAAAACTAGAAGGGAAAAATCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.40% 9.20% 1.80% 37.60% NA
All Indica  2759 48.60% 0.40% 0.76% 50.20% NA
All Japonica  1512 68.00% 27.00% 3.97% 1.06% NA
Aus  269 0.40% 0.00% 0.74% 98.88% NA
Indica I  595 38.70% 0.00% 2.02% 59.33% NA
Indica II  465 60.00% 1.30% 0.43% 38.28% NA
Indica III  913 46.80% 0.00% 0.00% 53.23% NA
Indica Intermediate  786 51.70% 0.60% 0.89% 46.82% NA
Temperate Japonica  767 94.90% 3.90% 0.78% 0.39% NA
Tropical Japonica  504 26.40% 65.10% 6.94% 1.59% NA
Japonica Intermediate  241 69.30% 20.70% 7.88% 2.07% NA
VI/Aromatic  96 17.70% 0.00% 0.00% 82.29% NA
Intermediate  90 44.40% 18.90% 2.22% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217639783 C -> T LOC_Os02g29640-LOC_Os02g29650 intergenic_region ; MODIFIER silent_mutation Average:18.409; most accessible tissue: Callus, score: 44.895 N N N N
vg0217639783 C -> DEL N N silent_mutation Average:18.409; most accessible tissue: Callus, score: 44.895 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217639783 NA 8.27E-10 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 NA 3.26E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 NA 3.41E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 NA 2.39E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 NA 6.81E-10 mr1093_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 NA 1.53E-13 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 NA 1.30E-06 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 NA 1.91E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 4.32E-08 NA mr1194_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 NA 1.44E-07 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 NA 2.81E-07 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 NA 3.39E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 NA 9.42E-06 mr1236_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 NA 4.42E-09 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 NA 2.07E-09 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 2.19E-06 3.89E-10 mr1250_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 NA 9.72E-09 mr1251_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 NA 6.82E-06 mr1253_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 NA 3.87E-08 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 NA 2.65E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 NA 4.88E-07 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 NA 3.10E-07 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 NA 1.08E-08 mr1435_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 6.13E-06 9.89E-07 mr1440_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 NA 5.37E-07 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 NA 6.72E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 NA 5.35E-08 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 6.83E-06 2.10E-06 mr1603_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 2.77E-06 2.77E-06 mr1603_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 NA 5.57E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 NA 9.86E-31 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 NA 1.30E-09 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 NA 1.34E-08 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 NA 2.46E-09 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217639783 NA 7.99E-06 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251