Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217631846:

Variant ID: vg0217631846 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 17631846
Reference Allele: C	Alternative Allele: A,CTGACCATTTGTTTTTA
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

TTAGTGGCATTCCTTGCCCGAGTGGCATCAACAGGAGGACTAGGTATTCCAAGTGGCTGTTAAGATGAAGGTATCATCCCTGCAAAACAAAATTAATTTT[C/A,CTGACCATTTGTTTTTA]
TTGGTTTAGATTTTTACTGACCATTTGTCTGAACTCAAAAGAATTAAAGCATACACGAACTTGGCATGTCCATATAAAAAATCATATATAGAGATAGAAC

Reverse complement sequence

GTTCTATCTCTATATATGATTTTTTATATGGACATGCCAAGTTCGTGTATGCTTTAATTCTTTTGAGTTCAGACAAATGGTCAGTAAAAATCTAAACCAA[G/T,TAAAAACAAATGGTCAG]
AAAATTAATTTTGTTTTGCAGGGATGATACCTTCATCTTAACAGCCACTTGGAATACCTAGTCCTCCTGTTGATGCCACTCGGGCAAGGAATGCCACTAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.20%	0.50%	3.41%	17.90%	NA
All Indica	2759	63.60%	0.80%	5.62%	30.01%	NA
All Japonica	1512	99.30%	0.10%	0.13%	0.40%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	69.70%	0.50%	7.73%	22.02%	NA
Indica II	465	57.40%	0.90%	7.31%	34.41%	NA
Indica III	913	66.70%	0.80%	2.85%	29.68%	NA
Indica Intermediate	786	58.90%	1.00%	6.23%	33.84%	NA
Temperate Japonica	767	99.00%	0.30%	0.13%	0.65%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	83.30%	0.00%	3.33%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0217631846	C -> A	LOC_Os02g29640.1	intron_variant ; MODIFIER	silent_mutation	Average:69.272; most accessible tissue: Zhenshan97 young leaf, score: 87.723	N	N	N	N
vg0217631846	C -> CTGACCATTTGTTTTTA	LOC_Os02g29640.1	intron_variant ; MODIFIER	N	Average:69.272; most accessible tissue: Zhenshan97 young leaf, score: 87.723	N	N	N	N
vg0217631846	C -> DEL	N	N	silent_mutation	Average:69.272; most accessible tissue: Zhenshan97 young leaf, score: 87.723	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0217631846	1.48E-06	2.62E-08	mr1089	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	3.50E-06	6.77E-09	mr1106	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	NA	1.31E-07	mr1106	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	5.02E-06	NA	mr1109	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	4.02E-06	3.43E-11	mr1109	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	NA	2.32E-09	mr1129	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	NA	1.13E-09	mr1236	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	NA	1.09E-09	mr1236	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	7.48E-06	NA	mr1251	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	NA	3.11E-10	mr1251	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	2.57E-06	6.46E-20	mr1255	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	8.20E-06	4.42E-09	mr1255	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	9.86E-07	NA	mr1257	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	6.98E-06	2.70E-11	mr1257	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	6.35E-06	NA	mr1423	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	1.02E-06	4.04E-10	mr1423	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	6.03E-06	NA	mr1435	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	9.84E-06	9.38E-10	mr1435	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	3.08E-06	NA	mr1599	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	6.66E-07	1.80E-09	mr1599	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	NA	3.28E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	1.92E-06	1.21E-07	mr1901	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	NA	4.87E-08	mr1901	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	NA	4.44E-08	mr1089_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	4.72E-06	NA	mr1109_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	NA	2.14E-12	mr1109_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	NA	2.28E-10	mr1129_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	NA	2.95E-08	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	NA	1.55E-11	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	NA	3.36E-10	mr1251_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	3.56E-06	1.07E-23	mr1255_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	NA	2.30E-09	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	4.09E-06	8.00E-34	mr1257_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	NA	4.27E-12	mr1257_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	NA	7.28E-06	mr1423_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	NA	4.03E-10	mr1435_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	NA	5.53E-09	mr1599_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217631846	NA	4.16E-06	mr1880_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251