Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217616831:

Variant ID: vg0217616831 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 17616831
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:

GGAGGAAAGTTAGTACCATTGACATGAGCATATGTAACTATTAAATAGCATAATACCTATTGTTTTCTTTGTCTGTGCTTGGGTTCTGATTATGTCCTTC[T/G]
TTTTACCCCTTGTTTCGTAGATGAAGTCAGTCCGATTAGTCAGTTTGTATGTTCTTCCTGTAGGACCTGTAAGCCTCTTCCTGCTTTGATTGCTCTGGTT

Reverse complement sequence

AACCAGAGCAATCAAAGCAGGAAGAGGCTTACAGGTCCTACAGGAAGAACATACAAACTGACTAATCGGACTGACTTCATCTACGAAACAAGGGGTAAAA[A/C]
GAAGGACATAATCAGAACCCAAGCACAGACAAAGAAAACAATAGGTATTATGCTATTTAATAGTTACATATGCTCATGTCAATGGTACTAACTTTCCTCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.50%	40.50%	16.72%	1.31%	NA
All Indica	2759	12.90%	66.80%	18.48%	1.81%	NA
All Japonica	1512	98.70%	0.50%	0.79%	0.00%	NA
Aus	269	17.80%	16.40%	62.08%	3.72%	NA
Indica I	595	8.70%	72.10%	17.48%	1.68%	NA
Indica II	465	16.30%	54.20%	21.51%	7.96%	NA
Indica III	913	16.60%	65.10%	18.29%	0.00%	NA
Indica Intermediate	786	9.80%	72.10%	17.68%	0.38%	NA
Temperate Japonica	767	99.00%	0.40%	0.65%	0.00%	NA
Tropical Japonica	504	98.80%	0.40%	0.79%	0.00%	NA
Japonica Intermediate	241	97.90%	0.80%	1.24%	0.00%	NA
VI/Aromatic	96	16.70%	3.10%	80.21%	0.00%	NA
Intermediate	90	50.00%	21.10%	26.67%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0217616831	T -> G	LOC_Os02g29600.1	upstream_gene_variant ; 2641.0bp to feature; MODIFIER	silent_mutation	Average:26.014; most accessible tissue: Minghui63 flag leaf, score: 54.348	N	N	N	N
vg0217616831	T -> G	LOC_Os02g29610.1	upstream_gene_variant ; 529.0bp to feature; MODIFIER	silent_mutation	Average:26.014; most accessible tissue: Minghui63 flag leaf, score: 54.348	N	N	N	N
vg0217616831	T -> G	LOC_Os02g29620.1	upstream_gene_variant ; 910.0bp to feature; MODIFIER	silent_mutation	Average:26.014; most accessible tissue: Minghui63 flag leaf, score: 54.348	N	N	N	N
vg0217616831	T -> G	LOC_Os02g29630.1	downstream_gene_variant ; 3846.0bp to feature; MODIFIER	silent_mutation	Average:26.014; most accessible tissue: Minghui63 flag leaf, score: 54.348	N	N	N	N
vg0217616831	T -> G	LOC_Os02g29610-LOC_Os02g29620	intergenic_region ; MODIFIER	silent_mutation	Average:26.014; most accessible tissue: Minghui63 flag leaf, score: 54.348	N	N	N	N
vg0217616831	T -> DEL	N	N	silent_mutation	Average:26.014; most accessible tissue: Minghui63 flag leaf, score: 54.348	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0217616831	NA	3.85E-06	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217616831	NA	8.93E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217616831	NA	2.21E-12	mr1281	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217616831	NA	1.12E-13	mr1441	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217616831	NA	8.40E-12	mr1609	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217616831	NA	9.06E-06	mr1613	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251