\
| Variant ID: vg0217616831 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 17616831 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 116. )
GGAGGAAAGTTAGTACCATTGACATGAGCATATGTAACTATTAAATAGCATAATACCTATTGTTTTCTTTGTCTGTGCTTGGGTTCTGATTATGTCCTTC[T/G]
TTTTACCCCTTGTTTCGTAGATGAAGTCAGTCCGATTAGTCAGTTTGTATGTTCTTCCTGTAGGACCTGTAAGCCTCTTCCTGCTTTGATTGCTCTGGTT
AACCAGAGCAATCAAAGCAGGAAGAGGCTTACAGGTCCTACAGGAAGAACATACAAACTGACTAATCGGACTGACTTCATCTACGAAACAAGGGGTAAAA[A/C]
GAAGGACATAATCAGAACCCAAGCACAGACAAAGAAAACAATAGGTATTATGCTATTTAATAGTTACATATGCTCATGTCAATGGTACTAACTTTCCTCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.50% | 40.50% | 16.72% | 1.31% | NA |
| All Indica | 2759 | 12.90% | 66.80% | 18.48% | 1.81% | NA |
| All Japonica | 1512 | 98.70% | 0.50% | 0.79% | 0.00% | NA |
| Aus | 269 | 17.80% | 16.40% | 62.08% | 3.72% | NA |
| Indica I | 595 | 8.70% | 72.10% | 17.48% | 1.68% | NA |
| Indica II | 465 | 16.30% | 54.20% | 21.51% | 7.96% | NA |
| Indica III | 913 | 16.60% | 65.10% | 18.29% | 0.00% | NA |
| Indica Intermediate | 786 | 9.80% | 72.10% | 17.68% | 0.38% | NA |
| Temperate Japonica | 767 | 99.00% | 0.40% | 0.65% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 0.40% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.80% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 16.70% | 3.10% | 80.21% | 0.00% | NA |
| Intermediate | 90 | 50.00% | 21.10% | 26.67% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0217616831 | T -> G | LOC_Os02g29600.1 | upstream_gene_variant ; 2641.0bp to feature; MODIFIER | silent_mutation | Average:26.014; most accessible tissue: Minghui63 flag leaf, score: 54.348 | N | N | N | N |
| vg0217616831 | T -> G | LOC_Os02g29610.1 | upstream_gene_variant ; 529.0bp to feature; MODIFIER | silent_mutation | Average:26.014; most accessible tissue: Minghui63 flag leaf, score: 54.348 | N | N | N | N |
| vg0217616831 | T -> G | LOC_Os02g29620.1 | upstream_gene_variant ; 910.0bp to feature; MODIFIER | silent_mutation | Average:26.014; most accessible tissue: Minghui63 flag leaf, score: 54.348 | N | N | N | N |
| vg0217616831 | T -> G | LOC_Os02g29630.1 | downstream_gene_variant ; 3846.0bp to feature; MODIFIER | silent_mutation | Average:26.014; most accessible tissue: Minghui63 flag leaf, score: 54.348 | N | N | N | N |
| vg0217616831 | T -> G | LOC_Os02g29610-LOC_Os02g29620 | intergenic_region ; MODIFIER | silent_mutation | Average:26.014; most accessible tissue: Minghui63 flag leaf, score: 54.348 | N | N | N | N |
| vg0217616831 | T -> DEL | N | N | silent_mutation | Average:26.014; most accessible tissue: Minghui63 flag leaf, score: 54.348 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0217616831 | NA | 3.85E-06 | mr1044 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217616831 | NA | 8.93E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217616831 | NA | 2.21E-12 | mr1281 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217616831 | NA | 1.12E-13 | mr1441 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217616831 | NA | 8.40E-12 | mr1609 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217616831 | NA | 9.06E-06 | mr1613 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |