\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217616831:

Variant ID: vg0217616831 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17616831
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


GGAGGAAAGTTAGTACCATTGACATGAGCATATGTAACTATTAAATAGCATAATACCTATTGTTTTCTTTGTCTGTGCTTGGGTTCTGATTATGTCCTTC[T/G]
TTTTACCCCTTGTTTCGTAGATGAAGTCAGTCCGATTAGTCAGTTTGTATGTTCTTCCTGTAGGACCTGTAAGCCTCTTCCTGCTTTGATTGCTCTGGTT

Reverse complement sequence

AACCAGAGCAATCAAAGCAGGAAGAGGCTTACAGGTCCTACAGGAAGAACATACAAACTGACTAATCGGACTGACTTCATCTACGAAACAAGGGGTAAAA[A/C]
GAAGGACATAATCAGAACCCAAGCACAGACAAAGAAAACAATAGGTATTATGCTATTTAATAGTTACATATGCTCATGTCAATGGTACTAACTTTCCTCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.50% 40.50% 16.72% 1.31% NA
All Indica  2759 12.90% 66.80% 18.48% 1.81% NA
All Japonica  1512 98.70% 0.50% 0.79% 0.00% NA
Aus  269 17.80% 16.40% 62.08% 3.72% NA
Indica I  595 8.70% 72.10% 17.48% 1.68% NA
Indica II  465 16.30% 54.20% 21.51% 7.96% NA
Indica III  913 16.60% 65.10% 18.29% 0.00% NA
Indica Intermediate  786 9.80% 72.10% 17.68% 0.38% NA
Temperate Japonica  767 99.00% 0.40% 0.65% 0.00% NA
Tropical Japonica  504 98.80% 0.40% 0.79% 0.00% NA
Japonica Intermediate  241 97.90% 0.80% 1.24% 0.00% NA
VI/Aromatic  96 16.70% 3.10% 80.21% 0.00% NA
Intermediate  90 50.00% 21.10% 26.67% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217616831 T -> G LOC_Os02g29600.1 upstream_gene_variant ; 2641.0bp to feature; MODIFIER silent_mutation Average:26.014; most accessible tissue: Minghui63 flag leaf, score: 54.348 N N N N
vg0217616831 T -> G LOC_Os02g29610.1 upstream_gene_variant ; 529.0bp to feature; MODIFIER silent_mutation Average:26.014; most accessible tissue: Minghui63 flag leaf, score: 54.348 N N N N
vg0217616831 T -> G LOC_Os02g29620.1 upstream_gene_variant ; 910.0bp to feature; MODIFIER silent_mutation Average:26.014; most accessible tissue: Minghui63 flag leaf, score: 54.348 N N N N
vg0217616831 T -> G LOC_Os02g29630.1 downstream_gene_variant ; 3846.0bp to feature; MODIFIER silent_mutation Average:26.014; most accessible tissue: Minghui63 flag leaf, score: 54.348 N N N N
vg0217616831 T -> G LOC_Os02g29610-LOC_Os02g29620 intergenic_region ; MODIFIER silent_mutation Average:26.014; most accessible tissue: Minghui63 flag leaf, score: 54.348 N N N N
vg0217616831 T -> DEL N N silent_mutation Average:26.014; most accessible tissue: Minghui63 flag leaf, score: 54.348 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217616831 NA 3.85E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217616831 NA 8.93E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217616831 NA 2.21E-12 mr1281 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217616831 NA 1.12E-13 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217616831 NA 8.40E-12 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217616831 NA 9.06E-06 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251