\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217616525:

Variant ID: vg0217616525 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17616525
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCTGAATTTTTTAATGGTGTCTGGCCATTCATTTTTTTCTTCTTTTGACCTCGTAAGGCGTTCTTTGGTGGGCCTTTGTCTATGATTTTTTGGTAAGAT[C/A,T]
TTCCTTCTCGATGTACACTAGAAAAGGGTAAGTCAAATCAGTAACACACAAACATAGAATATAAGTAAAAAATTATGGATGATGTAGAGAGTTCATACAT

Reverse complement sequence

ATGTATGAACTCTCTACATCATCCATAATTTTTTACTTATATTCTATGTTTGTGTGTTACTGATTTGACTTACCCTTTTCTAGTGTACATCGAGAAGGAA[G/T,A]
ATCTTACCAAAAAATCATAGACAAAGGCCCACCAAAGAACGCCTTACGAGGTCAAAAGAAGAAAAAAATGAATGGCCAGACACCATTAAAAAATTCAGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.00% 0.40% 0.61% 0.00% NA
All Indica  2759 98.30% 0.70% 1.01% 0.00% NA
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 96.20% 1.30% 2.52% 0.00% NA
Indica Intermediate  786 98.90% 0.60% 0.51% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217616525 C -> A LOC_Os02g29600.1 upstream_gene_variant ; 2335.0bp to feature; MODIFIER N Average:23.793; most accessible tissue: Minghui63 flag leaf, score: 45.977 N N N N
vg0217616525 C -> A LOC_Os02g29610.1 upstream_gene_variant ; 223.0bp to feature; MODIFIER N Average:23.793; most accessible tissue: Minghui63 flag leaf, score: 45.977 N N N N
vg0217616525 C -> A LOC_Os02g29620.1 upstream_gene_variant ; 1216.0bp to feature; MODIFIER N Average:23.793; most accessible tissue: Minghui63 flag leaf, score: 45.977 N N N N
vg0217616525 C -> A LOC_Os02g29630.1 downstream_gene_variant ; 4152.0bp to feature; MODIFIER N Average:23.793; most accessible tissue: Minghui63 flag leaf, score: 45.977 N N N N
vg0217616525 C -> A LOC_Os02g29610-LOC_Os02g29620 intergenic_region ; MODIFIER N Average:23.793; most accessible tissue: Minghui63 flag leaf, score: 45.977 N N N N
vg0217616525 C -> T LOC_Os02g29600.1 upstream_gene_variant ; 2335.0bp to feature; MODIFIER N Average:23.793; most accessible tissue: Minghui63 flag leaf, score: 45.977 N N N N
vg0217616525 C -> T LOC_Os02g29610.1 upstream_gene_variant ; 223.0bp to feature; MODIFIER N Average:23.793; most accessible tissue: Minghui63 flag leaf, score: 45.977 N N N N
vg0217616525 C -> T LOC_Os02g29620.1 upstream_gene_variant ; 1216.0bp to feature; MODIFIER N Average:23.793; most accessible tissue: Minghui63 flag leaf, score: 45.977 N N N N
vg0217616525 C -> T LOC_Os02g29630.1 downstream_gene_variant ; 4152.0bp to feature; MODIFIER N Average:23.793; most accessible tissue: Minghui63 flag leaf, score: 45.977 N N N N
vg0217616525 C -> T LOC_Os02g29610-LOC_Os02g29620 intergenic_region ; MODIFIER N Average:23.793; most accessible tissue: Minghui63 flag leaf, score: 45.977 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217616525 1.39E-06 NA mr1071 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217616525 3.66E-06 NA mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217616525 3.20E-06 NA mr1140 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251