Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217616525:

Variant ID: vg0217616525 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 17616525
Reference Allele: C	Alternative Allele: A,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCTGAATTTTTTAATGGTGTCTGGCCATTCATTTTTTTCTTCTTTTGACCTCGTAAGGCGTTCTTTGGTGGGCCTTTGTCTATGATTTTTTGGTAAGAT[C/A,T]
TTCCTTCTCGATGTACACTAGAAAAGGGTAAGTCAAATCAGTAACACACAAACATAGAATATAAGTAAAAAATTATGGATGATGTAGAGAGTTCATACAT

Reverse complement sequence

ATGTATGAACTCTCTACATCATCCATAATTTTTTACTTATATTCTATGTTTGTGTGTTACTGATTTGACTTACCCTTTTCTAGTGTACATCGAGAAGGAA[G/T,A]
ATCTTACCAAAAAATCATAGACAAAGGCCCACCAAAGAACGCCTTACGAGGTCAAAAGAAGAAAAAAATGAATGGCCAGACACCATTAAAAAATTCAGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	99.00%	0.40%	0.61%	0.00%	NA
All Indica	2759	98.30%	0.70%	1.01%	0.00%	NA
All Japonica	1512	99.90%	0.00%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.80%	0.00%	0.22%	0.00%	NA
Indica III	913	96.20%	1.30%	2.52%	0.00%	NA
Indica Intermediate	786	98.90%	0.60%	0.51%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0217616525	C -> A	LOC_Os02g29600.1	upstream_gene_variant ; 2335.0bp to feature; MODIFIER	N	Average:23.793; most accessible tissue: Minghui63 flag leaf, score: 45.977	N	N	N	N
vg0217616525	C -> A	LOC_Os02g29610.1	upstream_gene_variant ; 223.0bp to feature; MODIFIER	N	Average:23.793; most accessible tissue: Minghui63 flag leaf, score: 45.977	N	N	N	N
vg0217616525	C -> A	LOC_Os02g29620.1	upstream_gene_variant ; 1216.0bp to feature; MODIFIER	N	Average:23.793; most accessible tissue: Minghui63 flag leaf, score: 45.977	N	N	N	N
vg0217616525	C -> A	LOC_Os02g29630.1	downstream_gene_variant ; 4152.0bp to feature; MODIFIER	N	Average:23.793; most accessible tissue: Minghui63 flag leaf, score: 45.977	N	N	N	N
vg0217616525	C -> A	LOC_Os02g29610-LOC_Os02g29620	intergenic_region ; MODIFIER	N	Average:23.793; most accessible tissue: Minghui63 flag leaf, score: 45.977	N	N	N	N
vg0217616525	C -> T	LOC_Os02g29600.1	upstream_gene_variant ; 2335.0bp to feature; MODIFIER	N	Average:23.793; most accessible tissue: Minghui63 flag leaf, score: 45.977	N	N	N	N
vg0217616525	C -> T	LOC_Os02g29610.1	upstream_gene_variant ; 223.0bp to feature; MODIFIER	N	Average:23.793; most accessible tissue: Minghui63 flag leaf, score: 45.977	N	N	N	N
vg0217616525	C -> T	LOC_Os02g29620.1	upstream_gene_variant ; 1216.0bp to feature; MODIFIER	N	Average:23.793; most accessible tissue: Minghui63 flag leaf, score: 45.977	N	N	N	N
vg0217616525	C -> T	LOC_Os02g29630.1	downstream_gene_variant ; 4152.0bp to feature; MODIFIER	N	Average:23.793; most accessible tissue: Minghui63 flag leaf, score: 45.977	N	N	N	N
vg0217616525	C -> T	LOC_Os02g29610-LOC_Os02g29620	intergenic_region ; MODIFIER	N	Average:23.793; most accessible tissue: Minghui63 flag leaf, score: 45.977	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0217616525	1.39E-06	NA	mr1071	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217616525	3.66E-06	NA	mr1080	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217616525	3.20E-06	NA	mr1140	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251