Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0217615900:

Variant ID: vg0217615900 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 17615900
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

ATATAGTATTTGCACCTCACGTCGCTTGGCGTTAAGAACGGCTAGGTACCAGTGTGTATCTTTAATATTAATTAGGAGGAAAATCTGCAGATGTTCAACA[G/C]
TAAGATAGAGTCATAAATTGAATTAGCCATTACATAGATAGCTTAAATAAGTATTACCATGTCAAATGCTAGATAGTCGCGTGCCATATCTCTAATCCAT

Reverse complement sequence

ATGGATTAGAGATATGGCACGCGACTATCTAGCATTTGACATGGTAATACTTATTTAAGCTATCTATGTAATGGCTAATTCAATTTATGACTCTATCTTA[C/G]
TGTTGAACATCTGCAGATTTTCCTCCTAATTAATATTAAAGATACACACTGGTACCTAGCCGTTCTTAACGCCAAGCGACGTGAGGTGCAAATACTATAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.50%	2.00%	47.00%	4.46%	NA
All Indica	2759	19.20%	3.20%	70.06%	7.58%	NA
All Japonica	1512	99.60%	0.00%	0.33%	0.07%	NA
Aus	269	14.50%	2.20%	83.27%	0.00%	NA
Indica I	595	14.60%	2.00%	78.15%	5.21%	NA
Indica II	465	26.70%	3.90%	49.89%	19.57%	NA
Indica III	913	20.90%	3.00%	72.51%	3.61%	NA
Indica Intermediate	786	16.20%	3.90%	73.03%	6.87%	NA
Temperate Japonica	767	99.60%	0.00%	0.26%	0.13%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	99.20%	0.00%	0.83%	0.00%	NA
VI/Aromatic	96	62.50%	0.00%	37.50%	0.00%	NA
Intermediate	90	71.10%	2.20%	25.56%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0217615900	G -> DEL	N	N	silent_mutation	Average:33.991; most accessible tissue: Minghui63 flag leaf, score: 71.116	N	N	N	N
vg0217615900	G -> C	LOC_Os02g29600.1	upstream_gene_variant ; 1710.0bp to feature; MODIFIER	silent_mutation	Average:33.991; most accessible tissue: Minghui63 flag leaf, score: 71.116	N	N	N	N
vg0217615900	G -> C	LOC_Os02g29620.1	upstream_gene_variant ; 1841.0bp to feature; MODIFIER	silent_mutation	Average:33.991; most accessible tissue: Minghui63 flag leaf, score: 71.116	N	N	N	N
vg0217615900	G -> C	LOC_Os02g29630.1	downstream_gene_variant ; 4777.0bp to feature; MODIFIER	silent_mutation	Average:33.991; most accessible tissue: Minghui63 flag leaf, score: 71.116	N	N	N	N
vg0217615900	G -> C	LOC_Os02g29610.1	intron_variant ; MODIFIER	silent_mutation	Average:33.991; most accessible tissue: Minghui63 flag leaf, score: 71.116	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0217615900	5.95E-06	NA	mr1914	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217615900	NA	2.82E-08	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217615900	NA	7.00E-07	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251