\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217596619:

Variant ID: vg0217596619 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17596619
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TTTAGTACATCATTCTATGGAACTTGGGAGAATCCGATAGGAGGTTGAGGCACCGTGGTTGACGGAGTGGCCATGGTCAAATGGTATTGTCTCCCATTCC[G/A]
CTCAAACACGTAGAATGGTCCCAGCAACACTGGATCTCCAACAAGTGCAGGGTCTGGCATGGTTGGACGATTGCAGTGGAAACCAACTCTTATGCGGGCT

Reverse complement sequence

AGCCCGCATAAGAGTTGGTTTCCACTGCAATCGTCCAACCATGCCAGACCCTGCACTTGTTGGAGATCCAGTGTTGCTGGGACCATTCTACGTGTTTGAG[C/T]
GGAATGGGAGACAATACCATTTGACCATGGCCACTCCGTCAACCACGGTGCCTCAACCTCCTATCGGATTCTCCCAAGTTCCATAGAATGATGTACTAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.80% 24.10% 0.04% 0.00% NA
All Indica  2759 66.40% 33.60% 0.04% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 27.50% 72.10% 0.37% 0.00% NA
Indica I  595 77.30% 22.70% 0.00% 0.00% NA
Indica II  465 68.20% 31.60% 0.22% 0.00% NA
Indica III  913 54.30% 45.70% 0.00% 0.00% NA
Indica Intermediate  786 71.10% 28.90% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217596619 G -> A LOC_Os02g29570.1 upstream_gene_variant ; 2649.0bp to feature; MODIFIER silent_mutation Average:53.347; most accessible tissue: Minghui63 flag leaf, score: 71.116 N N N N
vg0217596619 G -> A LOC_Os02g29580.1 upstream_gene_variant ; 4317.0bp to feature; MODIFIER silent_mutation Average:53.347; most accessible tissue: Minghui63 flag leaf, score: 71.116 N N N N
vg0217596619 G -> A LOC_Os02g29570-LOC_Os02g29580 intergenic_region ; MODIFIER silent_mutation Average:53.347; most accessible tissue: Minghui63 flag leaf, score: 71.116 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217596619 4.05E-07 2.60E-13 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217596619 2.61E-06 2.60E-12 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217596619 NA 5.47E-07 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217596619 1.04E-06 3.18E-38 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217596619 NA 1.01E-19 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217596619 NA 3.85E-12 mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217596619 NA 1.02E-06 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217596619 2.10E-09 4.64E-13 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217596619 4.13E-09 3.82E-11 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217596619 9.45E-07 1.29E-15 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217596619 NA 8.17E-14 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217596619 NA 1.99E-09 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217596619 NA 1.11E-06 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217596619 1.47E-07 1.77E-15 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217596619 4.93E-07 2.69E-12 mr1610_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217596619 2.10E-06 3.22E-17 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217596619 NA 1.57E-10 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217596619 5.74E-13 1.73E-47 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217596619 1.99E-09 1.80E-22 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217596619 1.44E-06 1.29E-20 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217596619 NA 1.21E-10 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217596619 2.53E-07 1.57E-19 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217596619 3.34E-06 6.20E-17 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217596619 1.96E-08 1.35E-23 mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217596619 2.84E-06 4.41E-17 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251