\
| Variant ID: vg0217569334 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 17569334 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 200. )
TGCTTATATATAGATGGTATATATTAGCTTTTTAAATTTGAATGATAATATATTTAGGATTTTACGAACTCGGACAATGTTGACGCAATGACTCCGAGCT[T/C]
TTGCTTATAGAAAAGAACATGTCATGCGTGGATAAAAGAACGGTTAACATAAATCATAAGCATGGCAATGGAGAGTCCTCGACGAAGAAAAGGTAAACGA
TCGTTTACCTTTTCTTCGTCGAGGACTCTCCATTGCCATGCTTATGATTTATGTTAACCGTTCTTTTATCCACGCATGACATGTTCTTTTCTATAAGCAA[A/G]
AGCTCGGAGTCATTGCGTCAACATTGTCCGAGTTCGTAAAATCCTAAATATATTATCATTCAAATTTAAAAAGCTAATATATACCATCTATATATAAGCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.80% | 46.00% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 76.50% | 23.10% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 83.20% | 16.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 54.00% | 45.70% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 82.10% | 17.40% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 1.40% | 98.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.90% | 97.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 42.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0217569334 | T -> C | LOC_Os02g29540.1 | upstream_gene_variant ; 4594.0bp to feature; MODIFIER | silent_mutation | Average:52.13; most accessible tissue: Zhenshan97 root, score: 81.974 | N | N | N | N |
| vg0217569334 | T -> C | LOC_Os02g29540-LOC_Os02g29550 | intergenic_region ; MODIFIER | silent_mutation | Average:52.13; most accessible tissue: Zhenshan97 root, score: 81.974 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0217569334 | NA | 2.74E-13 | mr1138 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217569334 | NA | 5.15E-06 | mr1138 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217569334 | NA | 1.36E-07 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217569334 | NA | 6.19E-09 | mr1806 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217569334 | 2.95E-06 | NA | mr1036_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217569334 | 2.12E-06 | 1.55E-16 | mr1138_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217569334 | NA | 1.19E-08 | mr1138_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217569334 | 7.29E-06 | NA | mr1169_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217569334 | NA | 6.65E-09 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217569334 | NA | 5.54E-06 | mr1354_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217569334 | NA | 3.60E-12 | mr1806_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |