Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217540070:

Variant ID: vg0217540070 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 17540070
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

TTTAGACGCTAATTTGGAGTATTAAACATAGACTAATAAAAAAACTAATTTCATAAATGAGAGCTAATCTGCGAGACGAATTTTTTAAGCCTAATTAATC[C/T]
ATAATTATAATAACTTTACTGTAGCATTACATTGTCAAATCATAATGTAATTAAGCTCAAAAGATTCGTCTCGCGAATTAGTCCAAGGTTATAGAATGTA

Reverse complement sequence

TACATTCTATAACCTTGGACTAATTCGCGAGACGAATCTTTTGAGCTTAATTACATTATGATTTGACAATGTAATGCTACAGTAAAGTTATTATAATTAT[G/A]
GATTAATTAGGCTTAAAAAATTCGTCTCGCAGATTAGCTCTCATTTATGAAATTAGTTTTTTTATTAGTCTATGTTTAATACTCCAAATTAGCGTCTAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.30%	27.50%	0.19%	0.00%	NA
All Indica	2759	57.70%	42.00%	0.29%	0.00%	NA
All Japonica	1512	99.10%	0.90%	0.00%	0.00%	NA
Aus	269	61.30%	38.70%	0.00%	0.00%	NA
Indica I	595	61.50%	38.20%	0.34%	0.00%	NA
Indica II	465	87.10%	12.70%	0.22%	0.00%	NA
Indica III	913	36.00%	63.70%	0.22%	0.00%	NA
Indica Intermediate	786	62.50%	37.20%	0.38%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	97.80%	2.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	4.20%	1.04%	0.00%	NA
Intermediate	90	82.20%	17.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0217540070	C -> T	LOC_Os02g29510.2	downstream_gene_variant ; 625.0bp to feature; MODIFIER	silent_mutation	Average:72.089; most accessible tissue: Minghui63 flag leaf, score: 87.461	N	N	N	N
vg0217540070	C -> T	LOC_Os02g29520.1	downstream_gene_variant ; 1707.0bp to feature; MODIFIER	silent_mutation	Average:72.089; most accessible tissue: Minghui63 flag leaf, score: 87.461	N	N	N	N
vg0217540070	C -> T	LOC_Os02g29510.3	downstream_gene_variant ; 536.0bp to feature; MODIFIER	silent_mutation	Average:72.089; most accessible tissue: Minghui63 flag leaf, score: 87.461	N	N	N	N
vg0217540070	C -> T	LOC_Os02g29510-LOC_Os02g29520	intergenic_region ; MODIFIER	silent_mutation	Average:72.089; most accessible tissue: Minghui63 flag leaf, score: 87.461	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0217540070	NA	3.73E-06	mr1559	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070	8.90E-07	NA	mr1855	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070	NA	9.39E-06	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070	NA	6.22E-06	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070	1.92E-08	NA	mr1317_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070	2.16E-06	1.50E-06	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070	NA	3.76E-06	mr1379_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070	NA	4.34E-07	mr1559_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070	2.30E-07	NA	mr1818_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070	3.12E-10	NA	mr1855_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070	1.39E-08	NA	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070	6.07E-09	NA	mr1897_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070	9.91E-07	1.40E-06	mr1897_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070	3.83E-09	NA	mr1914_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070	1.70E-06	8.50E-06	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070	1.01E-09	NA	mr1927_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070	2.06E-06	3.12E-06	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251