\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217540070:

Variant ID: vg0217540070 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17540070
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


TTTAGACGCTAATTTGGAGTATTAAACATAGACTAATAAAAAAACTAATTTCATAAATGAGAGCTAATCTGCGAGACGAATTTTTTAAGCCTAATTAATC[C/T]
ATAATTATAATAACTTTACTGTAGCATTACATTGTCAAATCATAATGTAATTAAGCTCAAAAGATTCGTCTCGCGAATTAGTCCAAGGTTATAGAATGTA

Reverse complement sequence

TACATTCTATAACCTTGGACTAATTCGCGAGACGAATCTTTTGAGCTTAATTACATTATGATTTGACAATGTAATGCTACAGTAAAGTTATTATAATTAT[G/A]
GATTAATTAGGCTTAAAAAATTCGTCTCGCAGATTAGCTCTCATTTATGAAATTAGTTTTTTTATTAGTCTATGTTTAATACTCCAAATTAGCGTCTAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.30% 27.50% 0.19% 0.00% NA
All Indica  2759 57.70% 42.00% 0.29% 0.00% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 61.30% 38.70% 0.00% 0.00% NA
Indica I  595 61.50% 38.20% 0.34% 0.00% NA
Indica II  465 87.10% 12.70% 0.22% 0.00% NA
Indica III  913 36.00% 63.70% 0.22% 0.00% NA
Indica Intermediate  786 62.50% 37.20% 0.38% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 97.80% 2.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 4.20% 1.04% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217540070 C -> T LOC_Os02g29510.2 downstream_gene_variant ; 625.0bp to feature; MODIFIER silent_mutation Average:72.089; most accessible tissue: Minghui63 flag leaf, score: 87.461 N N N N
vg0217540070 C -> T LOC_Os02g29520.1 downstream_gene_variant ; 1707.0bp to feature; MODIFIER silent_mutation Average:72.089; most accessible tissue: Minghui63 flag leaf, score: 87.461 N N N N
vg0217540070 C -> T LOC_Os02g29510.3 downstream_gene_variant ; 536.0bp to feature; MODIFIER silent_mutation Average:72.089; most accessible tissue: Minghui63 flag leaf, score: 87.461 N N N N
vg0217540070 C -> T LOC_Os02g29510-LOC_Os02g29520 intergenic_region ; MODIFIER silent_mutation Average:72.089; most accessible tissue: Minghui63 flag leaf, score: 87.461 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217540070 NA 3.73E-06 mr1559 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070 8.90E-07 NA mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070 NA 9.39E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070 NA 6.22E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070 1.92E-08 NA mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070 2.16E-06 1.50E-06 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070 NA 3.76E-06 mr1379_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070 NA 4.34E-07 mr1559_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070 2.30E-07 NA mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070 3.12E-10 NA mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070 1.39E-08 NA mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070 6.07E-09 NA mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070 9.91E-07 1.40E-06 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070 3.83E-09 NA mr1914_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070 1.70E-06 8.50E-06 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070 1.01E-09 NA mr1927_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217540070 2.06E-06 3.12E-06 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251