\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217520188:

Variant ID: vg0217520188 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 17520188
Reference Allele: TAAAlternative Allele: TA,CAA,T
Primary Allele: TAASecondary Allele: CAA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTACAAACGATCGACGTATTTATTTATCGTACATTGATTTGAATATCCTCAAATCTATTCCTACCACGATGATTGGATTTGTATGCCACACGTCGTCCC[TAA/TA,CAA,T]
AAATCCTTAATTCACTACTGTCGTTCGTTCGTACGAGCATTCTCAAAATAATCCTATGACGACCGATGAATTCGTTCGTCAGGCGTTAAGCCTAGATTCC

Reverse complement sequence

GGAATCTAGGCTTAACGCCTGACGAACGAATTCATCGGTCGTCATAGGATTATTTTGAGAATGCTCGTACGAACGAACGACAGTAGTGAATTAAGGATTT[TTA/TA,TTG,A]
GGGACGACGTGTGGCATACAAATCCAATCATCGTGGTAGGAATAGATTTGAGGATATTCAAATCAATGTACGATAAATAAATACGTCGATCGTTTGTAGA

Allele Frequencies:

Populations Population SizeFrequency of TAA(primary allele) Frequency of CAA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.10% 1.30% 1.23% 11.34% TA: 0.04%
All Indica  2759 77.00% 2.10% 1.99% 18.81% TA: 0.07%
All Japonica  1512 99.30% 0.00% 0.07% 0.60% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 66.40% 8.40% 2.18% 23.03% NA
Indica II  465 59.80% 0.20% 4.30% 35.48% TA: 0.22%
Indica III  913 99.50% 0.10% 0.11% 0.33% NA
Indica Intermediate  786 69.10% 0.90% 2.67% 27.23% TA: 0.13%
Temperate Japonica  767 99.00% 0.00% 0.13% 0.91% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.20% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 1.10% 2.22% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217520188 TAA -> TA LOC_Os02g29480.1 upstream_gene_variant ; 4456.0bp to feature; MODIFIER silent_mutation Average:86.633; most accessible tissue: Minghui63 flower, score: 91.017 N N N N
vg0217520188 TAA -> TA LOC_Os02g29490.1 downstream_gene_variant ; 560.0bp to feature; MODIFIER silent_mutation Average:86.633; most accessible tissue: Minghui63 flower, score: 91.017 N N N N
vg0217520188 TAA -> TA LOC_Os02g29500.1 downstream_gene_variant ; 231.0bp to feature; MODIFIER silent_mutation Average:86.633; most accessible tissue: Minghui63 flower, score: 91.017 N N N N
vg0217520188 TAA -> TA LOC_Os02g29490-LOC_Os02g29500 intergenic_region ; MODIFIER silent_mutation Average:86.633; most accessible tissue: Minghui63 flower, score: 91.017 N N N N
vg0217520188 TAA -> T LOC_Os02g29480.1 upstream_gene_variant ; 4455.0bp to feature; MODIFIER N Average:86.633; most accessible tissue: Minghui63 flower, score: 91.017 N N N N
vg0217520188 TAA -> T LOC_Os02g29490.1 downstream_gene_variant ; 559.0bp to feature; MODIFIER N Average:86.633; most accessible tissue: Minghui63 flower, score: 91.017 N N N N
vg0217520188 TAA -> T LOC_Os02g29500.1 downstream_gene_variant ; 232.0bp to feature; MODIFIER N Average:86.633; most accessible tissue: Minghui63 flower, score: 91.017 N N N N
vg0217520188 TAA -> T LOC_Os02g29490-LOC_Os02g29500 intergenic_region ; MODIFIER N Average:86.633; most accessible tissue: Minghui63 flower, score: 91.017 N N N N
vg0217520188 TAA -> DEL N N silent_mutation Average:86.633; most accessible tissue: Minghui63 flower, score: 91.017 N N N N
vg0217520188 TAA -> CAA LOC_Os02g29480.1 upstream_gene_variant ; 4454.0bp to feature; MODIFIER silent_mutation Average:86.633; most accessible tissue: Minghui63 flower, score: 91.017 N N N N
vg0217520188 TAA -> CAA LOC_Os02g29490.1 downstream_gene_variant ; 558.0bp to feature; MODIFIER silent_mutation Average:86.633; most accessible tissue: Minghui63 flower, score: 91.017 N N N N
vg0217520188 TAA -> CAA LOC_Os02g29500.1 downstream_gene_variant ; 233.0bp to feature; MODIFIER silent_mutation Average:86.633; most accessible tissue: Minghui63 flower, score: 91.017 N N N N
vg0217520188 TAA -> CAA LOC_Os02g29490-LOC_Os02g29500 intergenic_region ; MODIFIER silent_mutation Average:86.633; most accessible tissue: Minghui63 flower, score: 91.017 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0217520188 TAA CAA -0.01 -0.01 0.0 -0.02 -0.01 -0.01
vg0217520188 TAA T -0.02 -0.03 -0.06 -0.05 -0.05 -0.02
vg0217520188 TAA TA -0.01 0.0 -0.02 -0.04 -0.02 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217520188 NA 1.32E-06 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217520188 NA 2.03E-06 mr1106 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217520188 6.39E-06 NA mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217520188 NA 3.89E-09 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217520188 NA 8.73E-08 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217520188 NA 5.03E-07 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217520188 7.89E-06 NA mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217520188 NA 2.15E-07 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217520188 6.81E-06 NA mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217520188 NA 4.70E-09 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217520188 3.54E-07 NA mr1423 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217520188 1.82E-07 3.82E-08 mr1423 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217520188 NA 3.32E-07 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217520188 7.98E-06 NA mr1599 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217520188 6.92E-06 1.45E-06 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217520188 NA 3.74E-06 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217520188 NA 5.35E-09 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217520188 NA 5.99E-09 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217520188 NA 1.47E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217520188 NA 1.13E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217520188 NA 3.31E-06 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217520188 NA 1.53E-08 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217520188 NA 2.96E-06 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251