\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217517982:

Variant ID: vg0217517982 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17517982
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.84, C: 0.16, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TGGGACAAGTGAAAGGTGTGCATGTGTTCACAAGGCTACTGTGTTTCTTAAGAAAAAGTTTATTTTTCACATATCATACCAATACAAAATCAAAATGACT[T/C]
GAATACCCCTATTTTATTAAATCTCAAGATAATTATTCCTCATTTTATCTACTCTCATATAGTTATTTTCTATTTTTACAAATTTTAATGTAATGATTAT

Reverse complement sequence

ATAATCATTACATTAAAATTTGTAAAAATAGAAAATAACTATATGAGAGTAGATAAAATGAGGAATAATTATCTTGAGATTTAATAAAATAGGGGTATTC[A/G]
AGTCATTTTGATTTTGTATTGGTATGATATGTGAAAAATAAACTTTTTCTTAAGAAACACAGTAGCCTTGTGAACACATGCACACCTTTCACTTGTCCCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.00% 26.80% 0.25% 0.00% NA
All Indica  2759 63.90% 35.70% 0.40% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 39.00% 61.00% 0.00% 0.00% NA
Indica I  595 74.60% 25.20% 0.17% 0.00% NA
Indica II  465 65.60% 34.00% 0.43% 0.00% NA
Indica III  913 51.30% 48.30% 0.44% 0.00% NA
Indica Intermediate  786 69.60% 29.90% 0.51% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 10.40% 89.60% 0.00% 0.00% NA
Intermediate  90 73.30% 25.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217517982 T -> C LOC_Os02g29480.1 upstream_gene_variant ; 2248.0bp to feature; MODIFIER silent_mutation Average:59.828; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0217517982 T -> C LOC_Os02g29490.1 upstream_gene_variant ; 1391.0bp to feature; MODIFIER silent_mutation Average:59.828; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0217517982 T -> C LOC_Os02g29500.1 downstream_gene_variant ; 2439.0bp to feature; MODIFIER silent_mutation Average:59.828; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0217517982 T -> C LOC_Os02g29480-LOC_Os02g29490 intergenic_region ; MODIFIER silent_mutation Average:59.828; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217517982 1.21E-06 2.28E-09 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217517982 3.13E-06 8.45E-13 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217517982 NA 5.53E-09 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217517982 NA 7.92E-06 mr1610 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217517982 NA 6.74E-07 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217517982 4.37E-10 3.34E-38 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217517982 1.49E-07 1.18E-24 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217517982 NA 5.06E-06 mr1897 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217517982 9.41E-07 NA mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217517982 3.39E-06 1.77E-08 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217517982 3.66E-08 NA mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217517982 4.51E-09 4.58E-11 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217517982 5.23E-11 1.20E-16 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217517982 1.49E-09 1.53E-18 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217517982 NA 5.38E-08 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217517982 NA 2.67E-12 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217517982 NA 1.60E-09 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217517982 1.37E-08 4.16E-12 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217517982 8.96E-09 4.23E-14 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217517982 1.84E-10 1.86E-18 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217517982 6.42E-09 1.60E-14 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217517982 1.24E-14 2.70E-45 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217517982 3.03E-10 3.68E-27 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217517982 3.56E-11 4.55E-22 mr1897_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217517982 7.58E-09 1.81E-15 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217517982 6.34E-12 1.17E-23 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217517982 3.40E-09 5.59E-20 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217517982 6.45E-14 3.83E-23 mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217517982 6.87E-11 2.53E-21 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251