\
| Variant ID: vg0217494680 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 17494680 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 295. )
CAAGCTTTCTCTCTCTTTTGACAACGGACCAAGAGACTCCTCTAAATGCTGCATAATTGAGCAATAACCGATTATACACATGTTGCATCATAGTGCATAA[G/A]
CCCAAGTGTAAGCATGTCATTGATAAAAAAAGCACCCCCAACATTTCCGGGACTCGAAACAATAGCAAGCCAAGTGAACCACAAGCGTTTCCTGGAAAGA
TCTTTCCAGGAAACGCTTGTGGTTCACTTGGCTTGCTATTGTTTCGAGTCCCGGAAATGTTGGGGGTGCTTTTTTTATCAATGACATGCTTACACTTGGG[C/T]
TTATGCACTATGATGCAACATGTGTATAATCGGTTATTGCTCAATTATGCAGCATTTAGAGGAGTCTCTTGGTCCGTTGTCAAAAGAGAGAGAAAGCTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.00% | 32.90% | 0.08% | 0.02% | NA |
| All Indica | 2759 | 50.50% | 49.40% | 0.14% | 0.04% | NA |
| All Japonica | 1512 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 73.60% | 26.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 62.70% | 37.00% | 0.17% | 0.17% | NA |
| Indica II | 465 | 82.80% | 16.80% | 0.43% | 0.00% | NA |
| Indica III | 913 | 22.70% | 77.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 54.30% | 45.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 8.30% | 91.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 26.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0217494680 | G -> A | LOC_Os02g29464.1 | intron_variant ; MODIFIER | silent_mutation | Average:41.283; most accessible tissue: Callus, score: 84.458 | N | N | N | N |
| vg0217494680 | G -> DEL | N | N | silent_mutation | Average:41.283; most accessible tissue: Callus, score: 84.458 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0217494680 | 7.45E-07 | 6.61E-12 | mr1317 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217494680 | 2.89E-06 | 9.47E-07 | mr1317 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217494680 | NA | 2.27E-08 | mr1610 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217494680 | 1.47E-07 | NA | mr1855 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217494680 | 1.27E-07 | 1.40E-08 | mr1855 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217494680 | 7.19E-06 | 9.59E-10 | mr1927 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217494680 | 3.26E-08 | 4.69E-11 | mr1317_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217494680 | 3.45E-08 | 4.46E-08 | mr1317_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217494680 | 2.83E-06 | NA | mr1610_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217494680 | 7.96E-08 | NA | mr1818_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217494680 | 5.06E-07 | 2.75E-07 | mr1818_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217494680 | 6.83E-12 | NA | mr1855_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217494680 | 1.33E-10 | 1.88E-08 | mr1855_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217494680 | 1.44E-09 | NA | mr1897_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217494680 | 1.16E-08 | 3.11E-08 | mr1897_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217494680 | 1.67E-08 | NA | mr1914_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217494680 | 3.75E-08 | 1.44E-07 | mr1914_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217494680 | 2.43E-08 | NA | mr1927_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217494680 | 6.45E-07 | 6.04E-07 | mr1927_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |