Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0217461610:

Variant ID: vg0217461610 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17461610
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCGTTGGCAACTCTCGCCGCCCGCAAGCTTCTTCCTTCAGCCACCAGTTGCTTCTTCCCCACCACTTCATGGGGGCGGGGGCGGCGGATCCACCCGCCG[C/G]
AGAGCCCACGGCGACAGATCCGCCTGCCACGACGCCAGCGGCATCGGCAGCTCCCATCGCCCACTAGCTACTCCCTCGTGGCATTTTTTGGGGCCGACGA

Reverse complement sequence

TCGTCGGCCCCAAAAAATGCCACGAGGGAGTAGCTAGTGGGCGATGGGAGCTGCCGATGCCGCTGGCGTCGTGGCAGGCGGATCTGTCGCCGTGGGCTCT[G/C]
CGGCGGGTGGATCCGCCGCCCCCGCCCCCATGAAGTGGTGGGGAAGAAGCAACTGGTGGCTGAAGGAAGAAGCTTGCGGGCGGCGAGAGTTGCCAACGCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.00% 3.60% 0.40% 0.00% NA
All Indica  2759 93.30% 6.00% 0.69% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.30% 0.00% 0.67% 0.00% NA
Indica II  465 80.60% 16.30% 3.01% 0.00% NA
Indica III  913 94.50% 5.50% 0.00% 0.00% NA
Indica Intermediate  786 94.80% 5.10% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217461610 C -> G LOC_Os02g29390.1 upstream_gene_variant ; 4429.0bp to feature; MODIFIER silent_mutation Average:94.023; most accessible tissue: Minghui63 panicle, score: 98.254 N N N N
vg0217461610 C -> G LOC_Os02g29400.1 upstream_gene_variant ; 2410.0bp to feature; MODIFIER silent_mutation Average:94.023; most accessible tissue: Minghui63 panicle, score: 98.254 N N N N
vg0217461610 C -> G LOC_Os02g29410.1 downstream_gene_variant ; 3754.0bp to feature; MODIFIER silent_mutation Average:94.023; most accessible tissue: Minghui63 panicle, score: 98.254 N N N N
vg0217461610 C -> G LOC_Os02g29390-LOC_Os02g29400 intergenic_region ; MODIFIER silent_mutation Average:94.023; most accessible tissue: Minghui63 panicle, score: 98.254 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0217461610 C G 0.01 0.01 0.0 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217461610 NA 6.62E-07 mr1188 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217461610 3.47E-06 1.75E-09 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217461610 5.78E-06 2.64E-07 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217461610 2.44E-06 6.20E-15 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217461610 NA 2.11E-06 mr1931 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217461610 NA 5.06E-06 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217461610 3.04E-06 3.06E-10 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217461610 NA 2.70E-06 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217461610 NA 8.07E-08 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217461610 2.16E-09 6.46E-14 mr1855_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217461610 NA 4.85E-08 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217461610 2.73E-06 4.81E-09 mr1914_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217461610 NA 5.73E-07 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251