\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217459136:

Variant ID: vg0217459136 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17459136
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


AGACACATGCCCAGTTTATAAGAGGAATGGATAGCTTTCACCTCCTGGACATTTATTTGTCCATTTTTTTAACTAGTCCCTACGATCCTATTCACAGGTG[C/T]
ATGTCTATCATATCCCCTTTGGTCAGTAAAATATACTACCCTCTCCATTCTTTCTGTTTCTATCTTTTTCACACTTTAAGTTCACAAAATAAAATAATAA

Reverse complement sequence

TTATTATTTTATTTTGTGAACTTAAAGTGTGAAAAAGATAGAAACAGAAAGAATGGAGAGGGTAGTATATTTTACTGACCAAAGGGGATATGATAGACAT[G/A]
CACCTGTGAATAGGATCGTAGGGACTAGTTAAAAAAATGGACAAATAAATGTCCAGGAGGTGAAAGCTATCCATTCCTCTTATAAACTGGGCATGTGTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.80% 32.00% 0.17% 0.00% NA
All Indica  2759 50.90% 48.90% 0.25% 0.00% NA
All Japonica  1512 99.40% 0.60% 0.00% 0.00% NA
Aus  269 81.40% 18.60% 0.00% 0.00% NA
Indica I  595 62.70% 37.10% 0.17% 0.00% NA
Indica II  465 82.60% 16.80% 0.65% 0.00% NA
Indica III  913 22.30% 77.50% 0.11% 0.00% NA
Indica Intermediate  786 56.40% 43.40% 0.25% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 74.40% 24.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217459136 C -> T LOC_Os02g29390.1 upstream_gene_variant ; 1955.0bp to feature; MODIFIER silent_mutation Average:62.011; most accessible tissue: Zhenshan97 panicle, score: 88.888 N N N N
vg0217459136 C -> T LOC_Os02g29400.1 upstream_gene_variant ; 4884.0bp to feature; MODIFIER silent_mutation Average:62.011; most accessible tissue: Zhenshan97 panicle, score: 88.888 N N N N
vg0217459136 C -> T LOC_Os02g29380.1 downstream_gene_variant ; 3977.0bp to feature; MODIFIER silent_mutation Average:62.011; most accessible tissue: Zhenshan97 panicle, score: 88.888 N N N N
vg0217459136 C -> T LOC_Os02g29390-LOC_Os02g29400 intergenic_region ; MODIFIER silent_mutation Average:62.011; most accessible tissue: Zhenshan97 panicle, score: 88.888 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217459136 4.52E-08 3.93E-14 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136 8.49E-07 3.92E-07 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136 NA 8.30E-09 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136 4.60E-11 NA mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136 1.06E-06 NA mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136 5.57E-06 9.96E-11 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136 1.43E-08 5.07E-13 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136 4.56E-08 3.22E-08 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136 4.45E-08 NA mr1610_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136 3.59E-08 NA mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136 2.23E-06 3.73E-07 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136 4.02E-15 NA mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136 4.27E-09 6.99E-07 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136 1.96E-09 NA mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136 1.69E-08 1.72E-08 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136 1.31E-08 NA mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136 4.98E-08 1.49E-07 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136 8.44E-09 NA mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136 2.75E-06 1.08E-06 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251