Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217459136:

Variant ID: vg0217459136 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 17459136
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

AGACACATGCCCAGTTTATAAGAGGAATGGATAGCTTTCACCTCCTGGACATTTATTTGTCCATTTTTTTAACTAGTCCCTACGATCCTATTCACAGGTG[C/T]
ATGTCTATCATATCCCCTTTGGTCAGTAAAATATACTACCCTCTCCATTCTTTCTGTTTCTATCTTTTTCACACTTTAAGTTCACAAAATAAAATAATAA

Reverse complement sequence

TTATTATTTTATTTTGTGAACTTAAAGTGTGAAAAAGATAGAAACAGAAAGAATGGAGAGGGTAGTATATTTTACTGACCAAAGGGGATATGATAGACAT[G/A]
CACCTGTGAATAGGATCGTAGGGACTAGTTAAAAAAATGGACAAATAAATGTCCAGGAGGTGAAAGCTATCCATTCCTCTTATAAACTGGGCATGTGTCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.80%	32.00%	0.17%	0.00%	NA
All Indica	2759	50.90%	48.90%	0.25%	0.00%	NA
All Japonica	1512	99.40%	0.60%	0.00%	0.00%	NA
Aus	269	81.40%	18.60%	0.00%	0.00%	NA
Indica I	595	62.70%	37.10%	0.17%	0.00%	NA
Indica II	465	82.60%	16.80%	0.65%	0.00%	NA
Indica III	913	22.30%	77.50%	0.11%	0.00%	NA
Indica Intermediate	786	56.40%	43.40%	0.25%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	13.50%	86.50%	0.00%	0.00%	NA
Intermediate	90	74.40%	24.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0217459136	C -> T	LOC_Os02g29390.1	upstream_gene_variant ; 1955.0bp to feature; MODIFIER	silent_mutation	Average:62.011; most accessible tissue: Zhenshan97 panicle, score: 88.888	N	N	N	N
vg0217459136	C -> T	LOC_Os02g29400.1	upstream_gene_variant ; 4884.0bp to feature; MODIFIER	silent_mutation	Average:62.011; most accessible tissue: Zhenshan97 panicle, score: 88.888	N	N	N	N
vg0217459136	C -> T	LOC_Os02g29380.1	downstream_gene_variant ; 3977.0bp to feature; MODIFIER	silent_mutation	Average:62.011; most accessible tissue: Zhenshan97 panicle, score: 88.888	N	N	N	N
vg0217459136	C -> T	LOC_Os02g29390-LOC_Os02g29400	intergenic_region ; MODIFIER	silent_mutation	Average:62.011; most accessible tissue: Zhenshan97 panicle, score: 88.888	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0217459136	4.52E-08	3.93E-14	mr1317	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136	8.49E-07	3.92E-07	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136	NA	8.30E-09	mr1610	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136	4.60E-11	NA	mr1855	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136	1.06E-06	NA	mr1855	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136	5.57E-06	9.96E-11	mr1927	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136	1.43E-08	5.07E-13	mr1317_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136	4.56E-08	3.22E-08	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136	4.45E-08	NA	mr1610_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136	3.59E-08	NA	mr1818_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136	2.23E-06	3.73E-07	mr1818_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136	4.02E-15	NA	mr1855_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136	4.27E-09	6.99E-07	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136	1.96E-09	NA	mr1897_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136	1.69E-08	1.72E-08	mr1897_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136	1.31E-08	NA	mr1914_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136	4.98E-08	1.49E-07	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136	8.44E-09	NA	mr1927_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217459136	2.75E-06	1.08E-06	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251