Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217365823:

Variant ID: vg0217365823 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 17365823
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.03, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

ACATAGACTGCAAGCCCTGCACACAAAAAAAGTGAATATTTGGGAAGAACCTAATATCAAATAAATAGAAGGGGTGAGCCTTTGAACCTAGGCCGGCAAG[C/T]
CCACCACCTTGTGGAGCTAGCCGGAAGACCCCTGGGCATTTCTCTTCCACATGGTTTCACACACTAAGCATGGGGTACATGTGAAGTGCACACATAAGAT

Reverse complement sequence

ATCTTATGTGTGCACTTCACATGTACCCCATGCTTAGTGTGTGAAACCATGTGGAAGAGAAATGCCCAGGGGTCTTCCGGCTAGCTCCACAAGGTGGTGG[G/A]
CTTGCCGGCCTAGGTTCAAAGGCTCACCCCTTCTATTTATTTGATATTAGGTTCTTCCCAAATATTCACTTTTTTTGTGTGCAGGGCTTGCAGTCTATGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.70%	23.30%	0.04%	0.00%	NA
All Indica	2759	67.90%	32.10%	0.04%	0.00%	NA
All Japonica	1512	98.20%	1.80%	0.00%	0.00%	NA
Aus	269	69.10%	30.90%	0.00%	0.00%	NA
Indica I	595	66.40%	33.60%	0.00%	0.00%	NA
Indica II	465	88.40%	11.60%	0.00%	0.00%	NA
Indica III	913	57.50%	42.40%	0.11%	0.00%	NA
Indica Intermediate	786	68.80%	31.20%	0.00%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	96.00%	4.00%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	14.60%	85.40%	0.00%	0.00%	NA
Intermediate	90	74.40%	24.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0217365823	C -> T	LOC_Os02g29230.1	downstream_gene_variant ; 2884.0bp to feature; MODIFIER	silent_mutation	Average:56.786; most accessible tissue: Zhenshan97 root, score: 68.908	N	N	N	N
vg0217365823	C -> T	LOC_Os02g29230-LOC_Os02g29240	intergenic_region ; MODIFIER	silent_mutation	Average:56.786; most accessible tissue: Zhenshan97 root, score: 68.908	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0217365823	NA	1.10E-07	mr1236	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823	8.01E-06	2.23E-07	mr1251	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823	1.31E-06	NA	mr1255	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823	4.27E-08	9.59E-09	mr1255	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823	NA	2.63E-07	mr1257	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823	5.33E-07	1.51E-11	mr1317	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823	NA	6.32E-06	mr1423	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823	NA	1.01E-06	mr1435	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823	NA	3.23E-06	mr1559	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823	NA	7.34E-06	mr1603	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823	3.43E-08	NA	mr1855	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823	1.65E-06	NA	mr1855	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823	4.10E-07	1.54E-09	mr1236_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823	NA	6.73E-06	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823	2.53E-07	1.63E-10	mr1317_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823	1.32E-06	NA	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823	NA	1.17E-06	mr1379_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823	NA	9.55E-09	mr1559_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823	8.27E-06	NA	mr1610_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823	8.48E-07	NA	mr1818_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823	7.00E-09	NA	mr1855_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823	NA	4.05E-06	mr1880_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823	3.29E-06	NA	mr1897_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823	1.20E-06	NA	mr1897_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823	3.55E-07	NA	mr1914_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823	3.81E-06	NA	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823	6.92E-08	NA	mr1927_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823	2.04E-06	NA	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251