\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217365823:

Variant ID: vg0217365823 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17365823
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.03, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


ACATAGACTGCAAGCCCTGCACACAAAAAAAGTGAATATTTGGGAAGAACCTAATATCAAATAAATAGAAGGGGTGAGCCTTTGAACCTAGGCCGGCAAG[C/T]
CCACCACCTTGTGGAGCTAGCCGGAAGACCCCTGGGCATTTCTCTTCCACATGGTTTCACACACTAAGCATGGGGTACATGTGAAGTGCACACATAAGAT

Reverse complement sequence

ATCTTATGTGTGCACTTCACATGTACCCCATGCTTAGTGTGTGAAACCATGTGGAAGAGAAATGCCCAGGGGTCTTCCGGCTAGCTCCACAAGGTGGTGG[G/A]
CTTGCCGGCCTAGGTTCAAAGGCTCACCCCTTCTATTTATTTGATATTAGGTTCTTCCCAAATATTCACTTTTTTTGTGTGCAGGGCTTGCAGTCTATGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.70% 23.30% 0.04% 0.00% NA
All Indica  2759 67.90% 32.10% 0.04% 0.00% NA
All Japonica  1512 98.20% 1.80% 0.00% 0.00% NA
Aus  269 69.10% 30.90% 0.00% 0.00% NA
Indica I  595 66.40% 33.60% 0.00% 0.00% NA
Indica II  465 88.40% 11.60% 0.00% 0.00% NA
Indica III  913 57.50% 42.40% 0.11% 0.00% NA
Indica Intermediate  786 68.80% 31.20% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 96.00% 4.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 14.60% 85.40% 0.00% 0.00% NA
Intermediate  90 74.40% 24.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217365823 C -> T LOC_Os02g29230.1 downstream_gene_variant ; 2884.0bp to feature; MODIFIER silent_mutation Average:56.786; most accessible tissue: Zhenshan97 root, score: 68.908 N N N N
vg0217365823 C -> T LOC_Os02g29230-LOC_Os02g29240 intergenic_region ; MODIFIER silent_mutation Average:56.786; most accessible tissue: Zhenshan97 root, score: 68.908 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217365823 NA 1.10E-07 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823 8.01E-06 2.23E-07 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823 1.31E-06 NA mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823 4.27E-08 9.59E-09 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823 NA 2.63E-07 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823 5.33E-07 1.51E-11 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823 NA 6.32E-06 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823 NA 1.01E-06 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823 NA 3.23E-06 mr1559 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823 NA 7.34E-06 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823 3.43E-08 NA mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823 1.65E-06 NA mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823 4.10E-07 1.54E-09 mr1236_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823 NA 6.73E-06 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823 2.53E-07 1.63E-10 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823 1.32E-06 NA mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823 NA 1.17E-06 mr1379_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823 NA 9.55E-09 mr1559_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823 8.27E-06 NA mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823 8.48E-07 NA mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823 7.00E-09 NA mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823 NA 4.05E-06 mr1880_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823 3.29E-06 NA mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823 1.20E-06 NA mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823 3.55E-07 NA mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823 3.81E-06 NA mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823 6.92E-08 NA mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217365823 2.04E-06 NA mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251