Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217345118:

Variant ID: vg0217345118 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17345118
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, T: 0.24, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


GAGGCGCCACGTCATCTGTTTGTTCAGATAATTAAAGATATGCATTAATCAGCGATAGGGCAGCTTAGGTTTTAATTGGTGTAGCGACGAGGGGTAGATG[C/T]
GTTTGTGCTCCTGTATCGTTCCTATTGGGCCCTGGTTGCTGTGCCGGCCCTTCCTTGCATATGGGCTTCTCGCTTCCTCATTACTTGGCCCACGTTTTAT

Reverse complement sequence

ATAAAACGTGGGCCAAGTAATGAGGAAGCGAGAAGCCCATATGCAAGGAAGGGCCGGCACAGCAACCAGGGCCCAATAGGAACGATACAGGAGCACAAAC[G/A]
CATCTACCCCTCGTCGCTACACCAATTAAAACCTAAGCTGCCCTATCGCTGATTAATGCATATCTTTAATTATCTGAACAAACAGATGACGTGGCGCCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.50% 29.80% 0.25% 1.44% NA
All Indica  2759 50.60% 46.60% 0.43% 2.32% NA
All Japonica  1512 98.40% 1.60% 0.00% 0.00% NA
Aus  269 69.90% 28.60% 0.00% 1.49% NA
Indica I  595 64.40% 34.80% 0.50% 0.34% NA
Indica II  465 81.50% 17.20% 0.43% 0.86% NA
Indica III  913 21.10% 73.50% 0.33% 5.04% NA
Indica Intermediate  786 56.10% 41.90% 0.51% 1.53% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 96.00% 4.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217345118 C -> T LOC_Os02g29220.1 downstream_gene_variant ; 3031.0bp to feature; MODIFIER silent_mutation Average:85.493; most accessible tissue: Callus, score: 94.614 N N N N
vg0217345118 C -> T LOC_Os02g29220-LOC_Os02g29230 intergenic_region ; MODIFIER silent_mutation Average:85.493; most accessible tissue: Callus, score: 94.614 N N N N
vg0217345118 C -> DEL N N silent_mutation Average:85.493; most accessible tissue: Callus, score: 94.614 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0217345118 C T -0.2 -0.14 -0.1 -0.14 -0.15 -0.16

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217345118 6.92E-08 1.90E-11 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217345118 1.14E-06 5.45E-07 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217345118 NA 6.14E-06 mr1559 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217345118 1.58E-11 NA mr1855 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217345118 1.11E-09 NA mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217345118 4.75E-07 2.74E-10 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217345118 2.41E-06 2.00E-06 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217345118 NA 4.69E-06 mr1379_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217345118 NA 1.60E-07 mr1559_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217345118 3.56E-06 NA mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217345118 6.58E-14 NA mr1855_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217345118 5.93E-09 NA mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217345118 3.38E-07 NA mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217345118 1.11E-07 2.53E-07 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217345118 6.85E-08 NA mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217345118 2.21E-06 5.54E-06 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217345118 1.71E-07 NA mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217345118 6.44E-06 NA mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251