RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0217328110:

Variant ID: vg0217328110 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 17328110
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.85, G: 0.15, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

CTTGGACAAAACGTGTAGGAGAGGACCAGAGCGCCTTGCCCACCTTGCGAACACCCATGCTGTTCACCTAGCCTCTGTGCTTGCAGATGCCTTCAAGGAC[G/T]
CCAGAGCTTCCCTGCATGTTTCAAGAACTATGAGAGAAGATGCGATAATTTACGATGGTTTTGTCCATCGATAGATGCAGCAGGCAGAACTTTTGTTCCA

Reverse complement sequence

TGGAACAAAAGTTCTGCCTGCTGCATCTATCGATGGACAAAACCATCGTAAATTATCGCATCTTCTCTCATAGTTCTTGAAACATGCAGGGAAGCTCTGG[C/A]
GTCCTTGAAGGCATCTGCAAGCACAGAGGCTAGGTGAACAGCATGGGTGTTCGCAAGGTGGGCAAGGCGCTCTGGTCCTCTCCTACACGTTTTGTCCAAG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.40%	34.60%	0.02%	0.00%	NA
All Indica	2759	95.50%	4.50%	0.00%	0.00%	NA
All Japonica	1512	3.00%	97.00%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	90.50%	9.50%	0.00%	0.00%	NA
Indica III	913	94.50%	5.50%	0.00%	0.00%	NA
Indica Intermediate	786	96.60%	3.40%	0.00%	0.00%	NA
Temperate Japonica	767	1.40%	98.60%	0.00%	0.00%	NA
Tropical Japonica	504	5.20%	94.80%	0.00%	0.00%	NA
Japonica Intermediate	241	3.70%	96.30%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	58.90%	40.00%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0217328110	G -> T	LOC_Os02g29210.1	missense_variant ; p.Ala360Glu; MODERATE	nonsynonymous_codon ; A360E	Average:73.699; most accessible tissue: Minghui63 panicle, score: 89.175	benign	0.074	TOLERATED	1.00

Showing 1 to 1 of 1 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0217328110	NA	2.77E-28	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217328110	NA	3.62E-40	mr1082	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217328110	5.16E-06	2.12E-12	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217328110	NA	3.09E-06	mr1083	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217328110	7.24E-08	1.79E-45	mr1089	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217328110	4.75E-07	4.14E-10	mr1089	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217328110	2.75E-08	1.98E-49	mr1093	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217328110	1.21E-07	1.65E-14	mr1093	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217328110	NA	1.19E-06	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217328110	3.35E-07	8.56E-34	mr1129	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 85 entries

Previous1 2 3 4 5…9Next

Search for Variation information by Variation ID:

Detailed information for vg0217328110:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact