\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217324370:

Variant ID: vg0217324370 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17324370
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


TGAGAATCTGGAAAAGCTAGGTTTCCCAGCTTCTGGCTTCTAGTTCATTTTTTGGATTCTAGAATTACAGCTTCTCAGAATCTGGACCAAAAGCTGGACT[G/A]
TTTGGGGGAGCTTCTAATTTTGGGAGACCCTATGTATGCGGTGAGTCAATACATCCTGCTAGGGGCCACCATTGACACGTGAACCGAAAATGAGTTTTCC

Reverse complement sequence

GGAAAACTCATTTTCGGTTCACGTGTCAATGGTGGCCCCTAGCAGGATGTATTGACTCACCGCATACATAGGGTCTCCCAAAATTAGAAGCTCCCCCAAA[C/T]
AGTCCAGCTTTTGGTCCAGATTCTGAGAAGCTGTAATTCTAGAATCCAAAAAATGAACTAGAAGCCAGAAGCTGGGAAACCTAGCTTTTCCAGATTCTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.90% 32.80% 0.13% 0.21% NA
All Indica  2759 55.10% 44.40% 0.22% 0.36% NA
All Japonica  1512 98.70% 1.30% 0.00% 0.00% NA
Aus  269 30.90% 69.10% 0.00% 0.00% NA
Indica I  595 38.50% 60.50% 0.17% 0.84% NA
Indica II  465 28.40% 70.80% 0.65% 0.22% NA
Indica III  913 85.40% 14.60% 0.00% 0.00% NA
Indica Intermediate  786 48.10% 51.10% 0.25% 0.51% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 10.40% 89.60% 0.00% 0.00% NA
Intermediate  90 63.30% 36.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217324370 G -> A LOC_Os02g29210.1 downstream_gene_variant ; 3195.0bp to feature; MODIFIER silent_mutation Average:53.073; most accessible tissue: Zhenshan97 young leaf, score: 71.497 N N N N
vg0217324370 G -> A LOC_Os02g29210.3 downstream_gene_variant ; 3222.0bp to feature; MODIFIER silent_mutation Average:53.073; most accessible tissue: Zhenshan97 young leaf, score: 71.497 N N N N
vg0217324370 G -> A LOC_Os02g29210.2 downstream_gene_variant ; 3222.0bp to feature; MODIFIER silent_mutation Average:53.073; most accessible tissue: Zhenshan97 young leaf, score: 71.497 N N N N
vg0217324370 G -> A LOC_Os02g29210.4 downstream_gene_variant ; 3222.0bp to feature; MODIFIER silent_mutation Average:53.073; most accessible tissue: Zhenshan97 young leaf, score: 71.497 N N N N
vg0217324370 G -> A LOC_Os02g29200-LOC_Os02g29210 intergenic_region ; MODIFIER silent_mutation Average:53.073; most accessible tissue: Zhenshan97 young leaf, score: 71.497 N N N N
vg0217324370 G -> DEL N N silent_mutation Average:53.073; most accessible tissue: Zhenshan97 young leaf, score: 71.497 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217324370 NA 9.44E-06 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 NA 5.74E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 NA 4.51E-06 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 4.34E-06 NA mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 NA 5.11E-06 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 NA 2.47E-06 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 2.84E-08 NA mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 5.02E-08 5.16E-10 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 NA 1.62E-07 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 NA 8.53E-10 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 4.87E-06 NA mr1423 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 NA 4.18E-06 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 8.17E-06 NA mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 NA 1.02E-06 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 NA 3.70E-10 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 1.87E-14 9.17E-23 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 5.08E-10 5.73E-09 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 NA 3.43E-07 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 NA 6.13E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 2.43E-09 NA mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 4.11E-09 6.74E-09 mr1317_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 NA 1.29E-13 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 NA 8.58E-06 mr1379_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 NA 8.39E-11 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 NA 6.63E-07 mr1559_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 6.03E-06 NA mr1585_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 8.71E-06 4.57E-06 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 NA 9.78E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 NA 2.27E-11 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 5.18E-08 9.56E-11 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 7.76E-08 6.63E-08 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 2.03E-15 1.42E-24 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 6.95E-09 2.04E-07 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 1.81E-09 4.22E-14 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 3.61E-10 6.60E-09 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 1.09E-10 NA mr1914_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 7.31E-09 2.24E-06 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 7.02E-09 NA mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370 2.16E-07 5.95E-06 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251