RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0217324370:

Variant ID: vg0217324370 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 17324370
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

TGAGAATCTGGAAAAGCTAGGTTTCCCAGCTTCTGGCTTCTAGTTCATTTTTTGGATTCTAGAATTACAGCTTCTCAGAATCTGGACCAAAAGCTGGACT[G/A]
TTTGGGGGAGCTTCTAATTTTGGGAGACCCTATGTATGCGGTGAGTCAATACATCCTGCTAGGGGCCACCATTGACACGTGAACCGAAAATGAGTTTTCC

Reverse complement sequence

GGAAAACTCATTTTCGGTTCACGTGTCAATGGTGGCCCCTAGCAGGATGTATTGACTCACCGCATACATAGGGTCTCCCAAAATTAGAAGCTCCCCCAAA[C/T]
AGTCCAGCTTTTGGTCCAGATTCTGAGAAGCTGTAATTCTAGAATCCAAAAAATGAACTAGAAGCCAGAAGCTGGGAAACCTAGCTTTTCCAGATTCTCA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.90%	32.80%	0.13%	0.21%	NA
All Indica	2759	55.10%	44.40%	0.22%	0.36%	NA
All Japonica	1512	98.70%	1.30%	0.00%	0.00%	NA
Aus	269	30.90%	69.10%	0.00%	0.00%	NA
Indica I	595	38.50%	60.50%	0.17%	0.84%	NA
Indica II	465	28.40%	70.80%	0.65%	0.22%	NA
Indica III	913	85.40%	14.60%	0.00%	0.00%	NA
Indica Intermediate	786	48.10%	51.10%	0.25%	0.51%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	97.10%	2.90%	0.00%	0.00%	NA
VI/Aromatic	96	10.40%	89.60%	0.00%	0.00%	NA
Intermediate	90	63.30%	36.70%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0217324370	G -> A	LOC_Os02g29210.1	downstream_gene_variant ; 3195.0bp to feature; MODIFIER	silent_mutation	Average:53.073; most accessible tissue: Zhenshan97 young leaf, score: 71.497	N	N	N	N
vg0217324370	G -> A	LOC_Os02g29210.3	downstream_gene_variant ; 3222.0bp to feature; MODIFIER	silent_mutation	Average:53.073; most accessible tissue: Zhenshan97 young leaf, score: 71.497	N	N	N	N
vg0217324370	G -> A	LOC_Os02g29210.2	downstream_gene_variant ; 3222.0bp to feature; MODIFIER	silent_mutation	Average:53.073; most accessible tissue: Zhenshan97 young leaf, score: 71.497	N	N	N	N
vg0217324370	G -> A	LOC_Os02g29210.4	downstream_gene_variant ; 3222.0bp to feature; MODIFIER	silent_mutation	Average:53.073; most accessible tissue: Zhenshan97 young leaf, score: 71.497	N	N	N	N
vg0217324370	G -> A	LOC_Os02g29200-LOC_Os02g29210	intergenic_region ; MODIFIER	silent_mutation	Average:53.073; most accessible tissue: Zhenshan97 young leaf, score: 71.497	N	N	N	N
vg0217324370	G -> DEL	N	N	silent_mutation	Average:53.073; most accessible tissue: Zhenshan97 young leaf, score: 71.497	N	N	N	N

Showing 1 to 6 of 6 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0217324370	NA	9.44E-06	mr1236	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370	NA	5.74E-06	mr1236	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370	NA	4.51E-06	mr1251	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370	4.34E-06	NA	mr1255	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370	NA	5.11E-06	mr1255	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370	NA	2.47E-06	mr1257	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370	2.84E-08	NA	mr1317	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370	5.02E-08	5.16E-10	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370	NA	1.62E-07	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217324370	NA	8.53E-10	mr1379	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 39 entries

Previous1 2 3 4Next

Search for Variation information by Variation ID:

Detailed information for vg0217324370:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact