Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217323055:

Variant ID: vg0217323055 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 17323055
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

TAGCTTCTGTTGTATTAGTTAACCACAAATTTGTAAATACCTATATATTTTGTAATAATATCTCCTTTGGAGCCTTATTCAAACGTATGCAATGAAGATC[C/T]
AGATTGTTGAACCTGTATCAATTTACTAATCTAGGGCTTGATACAGTCTAAACATGTCGGTTTCAGTTTCGGGTTGTTTCTTTGGACGTTCGTGGATAAT

Reverse complement sequence

ATTATCCACGAACGTCCAAAGAAACAACCCGAAACTGAAACCGACATGTTTAGACTGTATCAAGCCCTAGATTAGTAAATTGATACAGGTTCAACAATCT[G/A]
GATCTTCATTGCATACGTTTGAATAAGGCTCCAAAGGAGATATTATTACAAAATATATAGGTATTTACAAATTTGTGGTTAACTAATACAACAGAAGCTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.90%	30.50%	0.17%	1.38%	NA
All Indica	2759	49.60%	47.80%	0.25%	2.36%	NA
All Japonica	1512	98.40%	1.60%	0.00%	0.00%	NA
Aus	269	69.90%	30.10%	0.00%	0.00%	NA
Indica I	595	62.20%	35.80%	0.50%	1.51%	NA
Indica II	465	81.30%	18.50%	0.22%	0.00%	NA
Indica III	913	20.30%	74.80%	0.11%	4.82%	NA
Indica Intermediate	786	55.30%	42.90%	0.25%	1.53%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	96.00%	4.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	1.00%	1.04%	0.00%	NA
Intermediate	90	81.10%	18.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0217323055	C -> T	LOC_Os02g29200.1	downstream_gene_variant ; 4744.0bp to feature; MODIFIER	silent_mutation	Average:34.343; most accessible tissue: Zhenshan97 root, score: 54.262	N	N	N	N
vg0217323055	C -> T	LOC_Os02g29210.1	downstream_gene_variant ; 4510.0bp to feature; MODIFIER	silent_mutation	Average:34.343; most accessible tissue: Zhenshan97 root, score: 54.262	N	N	N	N
vg0217323055	C -> T	LOC_Os02g29210.3	downstream_gene_variant ; 4537.0bp to feature; MODIFIER	silent_mutation	Average:34.343; most accessible tissue: Zhenshan97 root, score: 54.262	N	N	N	N
vg0217323055	C -> T	LOC_Os02g29210.2	downstream_gene_variant ; 4537.0bp to feature; MODIFIER	silent_mutation	Average:34.343; most accessible tissue: Zhenshan97 root, score: 54.262	N	N	N	N
vg0217323055	C -> T	LOC_Os02g29210.4	downstream_gene_variant ; 4537.0bp to feature; MODIFIER	silent_mutation	Average:34.343; most accessible tissue: Zhenshan97 root, score: 54.262	N	N	N	N
vg0217323055	C -> T	LOC_Os02g29200-LOC_Os02g29210	intergenic_region ; MODIFIER	silent_mutation	Average:34.343; most accessible tissue: Zhenshan97 root, score: 54.262	N	N	N	N
vg0217323055	C -> DEL	N	N	silent_mutation	Average:34.343; most accessible tissue: Zhenshan97 root, score: 54.262	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0217323055	3.42E-07	4.37E-11	mr1317	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055	5.79E-06	1.25E-06	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055	1.68E-09	NA	mr1855	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055	2.69E-07	NA	mr1855	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055	1.42E-06	2.24E-10	mr1317_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055	NA	1.83E-06	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055	NA	9.12E-06	mr1559_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055	1.58E-06	8.49E-06	mr1585_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055	1.13E-06	NA	mr1818_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055	6.77E-06	5.95E-06	mr1818_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055	6.30E-12	NA	mr1855_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055	8.20E-08	NA	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055	6.65E-07	NA	mr1897_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055	3.08E-07	3.74E-07	mr1897_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055	2.80E-07	NA	mr1914_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055	NA	5.43E-06	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055	1.99E-07	NA	mr1927_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055	6.54E-06	7.51E-06	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251