\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217323055:

Variant ID: vg0217323055 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17323055
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


TAGCTTCTGTTGTATTAGTTAACCACAAATTTGTAAATACCTATATATTTTGTAATAATATCTCCTTTGGAGCCTTATTCAAACGTATGCAATGAAGATC[C/T]
AGATTGTTGAACCTGTATCAATTTACTAATCTAGGGCTTGATACAGTCTAAACATGTCGGTTTCAGTTTCGGGTTGTTTCTTTGGACGTTCGTGGATAAT

Reverse complement sequence

ATTATCCACGAACGTCCAAAGAAACAACCCGAAACTGAAACCGACATGTTTAGACTGTATCAAGCCCTAGATTAGTAAATTGATACAGGTTCAACAATCT[G/A]
GATCTTCATTGCATACGTTTGAATAAGGCTCCAAAGGAGATATTATTACAAAATATATAGGTATTTACAAATTTGTGGTTAACTAATACAACAGAAGCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.90% 30.50% 0.17% 1.38% NA
All Indica  2759 49.60% 47.80% 0.25% 2.36% NA
All Japonica  1512 98.40% 1.60% 0.00% 0.00% NA
Aus  269 69.90% 30.10% 0.00% 0.00% NA
Indica I  595 62.20% 35.80% 0.50% 1.51% NA
Indica II  465 81.30% 18.50% 0.22% 0.00% NA
Indica III  913 20.30% 74.80% 0.11% 4.82% NA
Indica Intermediate  786 55.30% 42.90% 0.25% 1.53% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 96.00% 4.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217323055 C -> T LOC_Os02g29200.1 downstream_gene_variant ; 4744.0bp to feature; MODIFIER silent_mutation Average:34.343; most accessible tissue: Zhenshan97 root, score: 54.262 N N N N
vg0217323055 C -> T LOC_Os02g29210.1 downstream_gene_variant ; 4510.0bp to feature; MODIFIER silent_mutation Average:34.343; most accessible tissue: Zhenshan97 root, score: 54.262 N N N N
vg0217323055 C -> T LOC_Os02g29210.3 downstream_gene_variant ; 4537.0bp to feature; MODIFIER silent_mutation Average:34.343; most accessible tissue: Zhenshan97 root, score: 54.262 N N N N
vg0217323055 C -> T LOC_Os02g29210.2 downstream_gene_variant ; 4537.0bp to feature; MODIFIER silent_mutation Average:34.343; most accessible tissue: Zhenshan97 root, score: 54.262 N N N N
vg0217323055 C -> T LOC_Os02g29210.4 downstream_gene_variant ; 4537.0bp to feature; MODIFIER silent_mutation Average:34.343; most accessible tissue: Zhenshan97 root, score: 54.262 N N N N
vg0217323055 C -> T LOC_Os02g29200-LOC_Os02g29210 intergenic_region ; MODIFIER silent_mutation Average:34.343; most accessible tissue: Zhenshan97 root, score: 54.262 N N N N
vg0217323055 C -> DEL N N silent_mutation Average:34.343; most accessible tissue: Zhenshan97 root, score: 54.262 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217323055 3.42E-07 4.37E-11 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055 5.79E-06 1.25E-06 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055 1.68E-09 NA mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055 2.69E-07 NA mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055 1.42E-06 2.24E-10 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055 NA 1.83E-06 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055 NA 9.12E-06 mr1559_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055 1.58E-06 8.49E-06 mr1585_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055 1.13E-06 NA mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055 6.77E-06 5.95E-06 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055 6.30E-12 NA mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055 8.20E-08 NA mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055 6.65E-07 NA mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055 3.08E-07 3.74E-07 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055 2.80E-07 NA mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055 NA 5.43E-06 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055 1.99E-07 NA mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217323055 6.54E-06 7.51E-06 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251