Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217322508:

Variant ID: vg0217322508 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 17322508
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

TGCTGATAACGTTACGATCAGAGCGCATGGGGACTAGAGTTTATGGAACAGGTACCACTCATGTTAGTAACTGAAAAGCTTTGCCATGACAAGGCTAATG[T/A]
GTTTGGCACATCATGGATTGCGGGTAAAGCGTACATCTACTGCAGTATGAATATTCTTAAAACTATTCGAATAGCCGTGCTCGCAGTTATCGGGCATTGG

Reverse complement sequence

CCAATGCCCGATAACTGCGAGCACGGCTATTCGAATAGTTTTAAGAATATTCATACTGCAGTAGATGTACGCTTTACCCGCAATCCATGATGTGCCAAAC[A/T]
CATTAGCCTTGTCATGGCAAAGCTTTTCAGTTACTAACATGAGTGGTACCTGTTCCATAAACTCTAGTCCCCATGCGCTCTGATCGTAACGTTATCAGCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.10%	16.60%	1.14%	0.15%	NA
All Indica	2759	73.30%	24.90%	1.67%	0.22%	NA
All Japonica	1512	98.60%	1.30%	0.07%	0.00%	NA
Aus	269	72.10%	24.90%	2.60%	0.37%	NA
Indica I	595	66.70%	29.60%	3.36%	0.34%	NA
Indica II	465	89.50%	10.10%	0.22%	0.22%	NA
Indica III	913	67.60%	30.70%	1.42%	0.33%	NA
Indica Intermediate	786	75.20%	23.30%	1.53%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	96.40%	3.40%	0.20%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0217322508	T -> A	LOC_Os02g29200.1	downstream_gene_variant ; 4197.0bp to feature; MODIFIER	silent_mutation	Average:40.663; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N
vg0217322508	T -> A	LOC_Os02g29200-LOC_Os02g29210	intergenic_region ; MODIFIER	silent_mutation	Average:40.663; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N
vg0217322508	T -> DEL	N	N	silent_mutation	Average:40.663; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0217322508	NA	7.61E-07	mr1109	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217322508	NA	5.70E-07	mr1129	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217322508	NA	5.60E-06	mr1236	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217322508	NA	1.46E-08	mr1251	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217322508	3.48E-07	NA	mr1255	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217322508	1.37E-06	1.71E-08	mr1255	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217322508	NA	7.28E-08	mr1257	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217322508	NA	2.55E-07	mr1423	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217322508	NA	2.72E-08	mr1435	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217322508	NA	3.53E-07	mr1089_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217322508	1.13E-07	NA	mr1109_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217322508	6.22E-06	9.98E-10	mr1109_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217322508	NA	1.85E-09	mr1129_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217322508	NA	2.50E-06	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217322508	7.18E-07	NA	mr1251_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217322508	4.62E-07	3.18E-10	mr1251_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217322508	4.62E-07	NA	mr1255_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217322508	1.99E-06	7.39E-11	mr1255_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217322508	NA	3.09E-10	mr1257_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217322508	NA	2.08E-06	mr1377_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217322508	NA	1.09E-06	mr1423_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217322508	6.62E-07	NA	mr1435_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217322508	3.99E-07	2.64E-10	mr1435_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217322508	NA	2.11E-07	mr1559_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217322508	7.54E-06	NA	mr1855_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251