Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0217296517:

Variant ID: vg0217296517 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 17296517
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTGCACATGATATGTTTAACATGAATGCACATGATAGGTTATGGACTTGCTTTTATTAAACTTTTATTTTAAGAAAGAGTAGTTATTTTACTTAAAATAA[A/G]
TTTTGCTTCTCTAGAGAGAAATATATTTAATAGCCACAAGTTATATTGATTTATATATAAATATACATCTTTACTTTCTTTGATCAACAAAGTAGTTCAT

Reverse complement sequence

ATGAACTACTTTGTTGATCAAAGAAAGTAAAGATGTATATTTATATATAAATCAATATAACTTGTGGCTATTAAATATATTTCTCTCTAGAGAAGCAAAA[T/C]
TTATTTTAAGTAAAATAACTACTCTTTCTTAAAATAAAAGTTTAATAAAAGCAAGTCCATAACCTATCATGTGCATTCATGTTAAACATATCATGTGCAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.70%	12.30%	0.02%	0.00%	NA
All Indica	2759	79.10%	20.80%	0.04%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.00%	2.00%	0.00%	0.00%	NA
Indica II	465	92.50%	7.50%	0.00%	0.00%	NA
Indica III	913	57.20%	42.80%	0.00%	0.00%	NA
Indica Intermediate	786	82.40%	17.40%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0217296517	A -> G	LOC_Os02g29180.1	upstream_gene_variant ; 4312.0bp to feature; MODIFIER	silent_mutation	Average:31.282; most accessible tissue: Zhenshan97 flower, score: 49.187	N	N	N	N
vg0217296517	A -> G	LOC_Os02g29170.1	downstream_gene_variant ; 612.0bp to feature; MODIFIER	silent_mutation	Average:31.282; most accessible tissue: Zhenshan97 flower, score: 49.187	N	N	N	N
vg0217296517	A -> G	LOC_Os02g29170-LOC_Os02g29180	intergenic_region ; MODIFIER	silent_mutation	Average:31.282; most accessible tissue: Zhenshan97 flower, score: 49.187	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0217296517	1.68E-06	NA	mr1109	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217296517	4.57E-08	NA	mr1129	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217296517	1.97E-07	3.24E-06	mr1129	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217296517	3.09E-06	NA	mr1251	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217296517	7.14E-07	NA	mr1257	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217296517	6.75E-06	NA	mr1257	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217296517	9.96E-06	NA	mr1423	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217296517	9.28E-06	5.97E-06	mr1423	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217296517	6.54E-06	NA	mr1089_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217296517	1.20E-06	NA	mr1109_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217296517	4.29E-06	NA	mr1109_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217296517	7.50E-07	NA	mr1129_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217296517	5.83E-07	NA	mr1129_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217296517	2.40E-06	NA	mr1251_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217296517	6.51E-07	NA	mr1253_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217296517	2.54E-06	2.15E-06	mr1253_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217296517	2.68E-08	NA	mr1255_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217296517	2.02E-07	7.79E-07	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217296517	2.51E-07	NA	mr1257_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217296517	4.55E-07	NA	mr1257_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217296517	2.87E-06	NA	mr1435_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251