\
| Variant ID: vg0217292905 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr02 | Position: 17292905 |
| Reference Allele: A | Alternative Allele: G,AG,AAAG,AAG,AAAAG |
| Primary Allele: A | Secondary Allele: AG |
Inferred Ancestral Allele: Not determined.
ACCTAGTTCGTATGCCTTCATCAGCAAGGACCTCGCTATAGGAGAGGGAGAGGATGAAGAAGGTGAGTGAAGGGAAGAAGAAAGTTTAAGTAAAAAAAAA[A/G,AG,AAAG,AAG,AAAAG]
GAAGAAGAAAGGAAGAAGAGCAAGATGGTCATTTCATCCCCAGATTTGGTGATGTGGCTTCTCATAGGCTAAAAATGGCACACAATCAAGAAATCTTCTC
GAGAAGATTTCTTGATTGTGTGCCATTTTTAGCCTATGAGAAGCCACATCACCAAATCTGGGGATGAAATGACCATCTTGCTCTTCTTCCTTTCTTCTTC[T/C,CT,CTTT,CTT,CTTTT]
TTTTTTTTTACTTAAACTTTCTTCTTCCCTTCACTCACCTTCTTCATCCTCTCCCTCTCCTATAGCGAGGTCCTTGCTGATGAAGGCATACGAACTAGGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of AG(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.60% | 27.10% | 1.38% | 0.17% | G: 22.37%; AAAG: 13.58%; AAG: 0.83%; AAAAG: 0.02% |
| All Indica | 2759 | 4.60% | 38.90% | 2.25% | 0.29% | G: 30.19%; AAAG: 22.44%; AAG: 1.34%; AAAAG: 0.04% |
| All Japonica | 1512 | 97.00% | 0.50% | 0.00% | 0.00% | G: 1.92%; AAAG: 0.66% |
| Aus | 269 | 0.00% | 66.50% | 0.00% | 0.00% | G: 33.09%; AAG: 0.37% |
| Indica I | 595 | 0.70% | 25.90% | 4.87% | 0.67% | G: 32.61%; AAAG: 31.60%; AAG: 3.70% |
| Indica II | 465 | 9.50% | 33.80% | 1.94% | 0.22% | AAAG: 42.15%; G: 11.61%; AAG: 0.86% |
| Indica III | 913 | 5.70% | 54.40% | 0.00% | 0.00% | G: 39.43%; AAAG: 0.44% |
| Indica Intermediate | 786 | 3.30% | 33.70% | 3.05% | 0.38% | AAAG: 29.39%; G: 28.63%; AAG: 1.40%; AAAAG: 0.13% |
| Temperate Japonica | 767 | 98.70% | 0.10% | 0.00% | 0.00% | AAAG: 0.91%; G: 0.26% |
| Tropical Japonica | 504 | 94.60% | 0.80% | 0.00% | 0.00% | G: 4.37%; AAAG: 0.20% |
| Japonica Intermediate | 241 | 96.30% | 0.80% | 0.00% | 0.00% | G: 2.07%; AAAG: 0.83% |
| VI/Aromatic | 96 | 9.40% | 5.20% | 0.00% | 0.00% | G: 85.42% |
| Intermediate | 90 | 37.80% | 16.70% | 3.33% | 0.00% | G: 26.67%; AAAG: 14.44%; AAG: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0217292905 | A -> AG | LOC_Os02g29160.1 | upstream_gene_variant ; 2706.0bp to feature; MODIFIER | silent_mutation | Average:51.433; most accessible tissue: Zhenshan97 young leaf, score: 75.039 | N | N | N | N |
| vg0217292905 | A -> AG | LOC_Os02g29170.1 | upstream_gene_variant ; 1018.0bp to feature; MODIFIER | silent_mutation | Average:51.433; most accessible tissue: Zhenshan97 young leaf, score: 75.039 | N | N | N | N |
| vg0217292905 | A -> AG | LOC_Os02g29160-LOC_Os02g29170 | intergenic_region ; MODIFIER | silent_mutation | Average:51.433; most accessible tissue: Zhenshan97 young leaf, score: 75.039 | N | N | N | N |
| vg0217292905 | A -> DEL | N | N | silent_mutation | Average:51.433; most accessible tissue: Zhenshan97 young leaf, score: 75.039 | N | N | N | N |
| vg0217292905 | A -> AAAAG | LOC_Os02g29160.1 | upstream_gene_variant ; 2706.0bp to feature; MODIFIER | silent_mutation | Average:51.433; most accessible tissue: Zhenshan97 young leaf, score: 75.039 | N | N | N | N |
| vg0217292905 | A -> AAAAG | LOC_Os02g29170.1 | upstream_gene_variant ; 1018.0bp to feature; MODIFIER | silent_mutation | Average:51.433; most accessible tissue: Zhenshan97 young leaf, score: 75.039 | N | N | N | N |
| vg0217292905 | A -> AAAAG | LOC_Os02g29160-LOC_Os02g29170 | intergenic_region ; MODIFIER | silent_mutation | Average:51.433; most accessible tissue: Zhenshan97 young leaf, score: 75.039 | N | N | N | N |
| vg0217292905 | A -> G | LOC_Os02g29160.1 | upstream_gene_variant ; 2705.0bp to feature; MODIFIER | silent_mutation | Average:51.433; most accessible tissue: Zhenshan97 young leaf, score: 75.039 | N | N | N | N |
| vg0217292905 | A -> G | LOC_Os02g29170.1 | upstream_gene_variant ; 1019.0bp to feature; MODIFIER | silent_mutation | Average:51.433; most accessible tissue: Zhenshan97 young leaf, score: 75.039 | N | N | N | N |
| vg0217292905 | A -> G | LOC_Os02g29160-LOC_Os02g29170 | intergenic_region ; MODIFIER | silent_mutation | Average:51.433; most accessible tissue: Zhenshan97 young leaf, score: 75.039 | N | N | N | N |
| vg0217292905 | A -> AAAG | LOC_Os02g29160.1 | upstream_gene_variant ; 2706.0bp to feature; MODIFIER | silent_mutation | Average:51.433; most accessible tissue: Zhenshan97 young leaf, score: 75.039 | N | N | N | N |
| vg0217292905 | A -> AAAG | LOC_Os02g29170.1 | upstream_gene_variant ; 1018.0bp to feature; MODIFIER | silent_mutation | Average:51.433; most accessible tissue: Zhenshan97 young leaf, score: 75.039 | N | N | N | N |
| vg0217292905 | A -> AAAG | LOC_Os02g29160-LOC_Os02g29170 | intergenic_region ; MODIFIER | silent_mutation | Average:51.433; most accessible tissue: Zhenshan97 young leaf, score: 75.039 | N | N | N | N |
| vg0217292905 | A -> AAG | LOC_Os02g29160.1 | upstream_gene_variant ; 2706.0bp to feature; MODIFIER | silent_mutation | Average:51.433; most accessible tissue: Zhenshan97 young leaf, score: 75.039 | N | N | N | N |
| vg0217292905 | A -> AAG | LOC_Os02g29170.1 | upstream_gene_variant ; 1018.0bp to feature; MODIFIER | silent_mutation | Average:51.433; most accessible tissue: Zhenshan97 young leaf, score: 75.039 | N | N | N | N |
| vg0217292905 | A -> AAG | LOC_Os02g29160-LOC_Os02g29170 | intergenic_region ; MODIFIER | silent_mutation | Average:51.433; most accessible tissue: Zhenshan97 young leaf, score: 75.039 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0217292905 | NA | 1.20E-06 | mr1109 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217292905 | NA | 2.05E-07 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217292905 | NA | 5.09E-07 | mr1236 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217292905 | NA | 5.06E-08 | mr1251 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217292905 | 7.27E-06 | 2.64E-06 | mr1253 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217292905 | NA | 1.35E-08 | mr1255 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217292905 | 8.33E-06 | 2.28E-09 | mr1257 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217292905 | NA | 5.10E-06 | mr1423 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217292905 | NA | 2.25E-08 | mr1435 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217292905 | NA | 3.07E-08 | mr1129_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217292905 | 2.96E-06 | 7.97E-06 | mr1236_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217292905 | 6.87E-06 | 2.07E-09 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217292905 | NA | 1.39E-07 | mr1255_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217292905 | NA | 7.70E-07 | mr1257_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217292905 | NA | 7.49E-06 | mr1880_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |