| Variant ID: vg0217282103 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr02 | Position: 17282103 |
| Reference Allele: G | Alternative Allele: C,GGCAATTCTCTC,GGCAATTCTCAC |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CACTACTTCGCCTTCGTCTTCGTCGCCTTCGTCTTCATCCAGCATGATTCATCGCCCGTATCTTCCTCGACTACACTTCGCTCTTCTCCGACAATTCTCC[G/C,GGCAATTCTCTC,GGCAATTCTCAC]
TCTATGCCGTTCTCACGCCGCGACCGTCATTGGCGTATGATTCATGGTGGTCCCCTACCTCACCCGCGCGGTATTGGCAACACCGTTGCGCGCGTTCGTC
GACGAACGCGCGCAACGGTGTTGCCAATACCGCGCGGGTGAGGTAGGGGACCACCATGAATCATACGCCAATGACGGTCGCGGCGTGAGAACGGCATAGA[C/G,GAGAGAATTGCC,GTGAGAATTGCC]
GGAGAATTGTCGGAGAAGAGCGAAGTGTAGTCGAGGAAGATACGGGCGATGAATCATGCTGGATGAAGACGAAGGCGACGAAGACGAAGGCGAAGTAGTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.00% | 34.60% | 0.08% | 0.00% | GGCAATTCTCTC: 14.33%; GGCAATTCTCAC: 0.02% |
| All Indica | 2759 | 78.10% | 4.50% | 0.14% | 0.00% | GGCAATTCTCTC: 17.25% |
| All Japonica | 1512 | 2.70% | 97.00% | 0.00% | 0.00% | GGCAATTCTCTC: 0.26% |
| Aus | 269 | 32.00% | 0.00% | 0.00% | 0.00% | GGCAATTCTCTC: 67.66%; GGCAATTCTCAC: 0.37% |
| Indica I | 595 | 77.30% | 0.70% | 0.34% | 0.00% | GGCAATTCTCTC: 21.68% |
| Indica II | 465 | 64.50% | 9.70% | 0.00% | 0.00% | GGCAATTCTCTC: 25.81% |
| Indica III | 913 | 82.90% | 5.70% | 0.00% | 0.00% | GGCAATTCTCTC: 11.39% |
| Indica Intermediate | 786 | 81.00% | 3.10% | 0.25% | 0.00% | GGCAATTCTCTC: 15.65% |
| Temperate Japonica | 767 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 4.80% | 94.60% | 0.00% | 0.00% | GGCAATTCTCTC: 0.60% |
| Japonica Intermediate | 241 | 3.30% | 96.30% | 0.00% | 0.00% | GGCAATTCTCTC: 0.41% |
| VI/Aromatic | 96 | 86.50% | 8.30% | 0.00% | 0.00% | GGCAATTCTCTC: 5.21% |
| Intermediate | 90 | 51.10% | 37.80% | 0.00% | 0.00% | GGCAATTCTCTC: 11.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0217282103 | G -> GGCAATTCTCTC | LOC_Os02g29160.1 | intron_variant ; MODIFIER | silent_mutation | Average:60.966; most accessible tissue: Zhenshan97 young leaf, score: 82.077 | N | N | N | N |
| vg0217282103 | G -> GGCAATTCTCAC | LOC_Os02g29160.1 | intron_variant ; MODIFIER | silent_mutation | Average:60.966; most accessible tissue: Zhenshan97 young leaf, score: 82.077 | N | N | N | N |
| vg0217282103 | G -> C | LOC_Os02g29160.1 | intron_variant ; MODIFIER | silent_mutation | Average:60.966; most accessible tissue: Zhenshan97 young leaf, score: 82.077 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0217282103 | 2.47E-06 | 3.32E-47 | mr1089 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217282103 | NA | 1.48E-08 | mr1089 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217282103 | NA | 7.32E-44 | mr1093 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217282103 | NA | 5.89E-09 | mr1093 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217282103 | NA | 1.07E-50 | mr1109 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217282103 | NA | 3.21E-11 | mr1109 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217282103 | 1.76E-08 | 5.42E-49 | mr1129 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217282103 | 2.87E-06 | 9.60E-14 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217282103 | NA | 3.18E-42 | mr1235 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217282103 | NA | 1.07E-08 | mr1235 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/