\
| Variant ID: vg0217282044 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 17282044 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 122. )
GGCCGGTGGTGCAGCTACCTCTACATGGCTACCGACGTCGCCATCCAGGCCGTTGGTCCCACTACTTCGCCTTCGTCTTCGTCGCCTTCGTCTTCATCCA[G/A]
CATGATTCATCGCCCGTATCTTCCTCGACTACACTTCGCTCTTCTCCGACAATTCTCCGTCTATGCCGTTCTCACGCCGCGACCGTCATTGGCGTATGAT
ATCATACGCCAATGACGGTCGCGGCGTGAGAACGGCATAGACGGAGAATTGTCGGAGAAGAGCGAAGTGTAGTCGAGGAAGATACGGGCGATGAATCATG[C/T]
TGGATGAAGACGAAGGCGACGAAGACGAAGGCGAAGTAGTGGGACCAACGGCCTGGATGGCGACGTCGGTAGCCATGTAGAGGTAGCTGCACCACCGGCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.80% | 21.40% | 1.84% | 0.00% | NA |
| All Indica | 2759 | 95.80% | 4.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 37.10% | 57.40% | 5.49% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 91.20% | 8.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 62.60% | 28.80% | 8.60% | 0.00% | NA |
| Tropical Japonica | 504 | 5.80% | 93.30% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 21.60% | 73.40% | 4.98% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 23.30% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0217282044 | G -> A | LOC_Os02g29160.1 | intron_variant ; MODIFIER | silent_mutation | Average:65.447; most accessible tissue: Zhenshan97 young leaf, score: 81.841 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0217282044 | NA | 4.18E-06 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217282044 | NA | 8.20E-19 | mr1518 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217282044 | NA | 1.86E-06 | mr1355_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217282044 | 8.51E-06 | 1.59E-10 | mr1749_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217282044 | NA | 1.70E-11 | mr1761_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217282044 | NA | 5.01E-10 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |