\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217270732:

Variant ID: vg0217270732 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17270732
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTGCCGCATGTGAAATGAGAAATGCCATTACCATTAATTAATATTCTTTTTGGCATAGCTCTGTGTATTATTAGTTCCACAAATATATAAATATATGA[T/C]
ACTAGATTTACAATCACGTTGATAACATTCAAATAAATTATTTTATACCAAATAAAACCTAAGTAATGAGAAAATTCTTTATGTACCCTAATAGTTTGCC

Reverse complement sequence

GGCAAACTATTAGGGTACATAAAGAATTTTCTCATTACTTAGGTTTTATTTGGTATAAAATAATTTATTTGAATGTTATCAACGTGATTGTAAATCTAGT[A/G]
TCATATATTTATATATTTGTGGAACTAATAATACACAGAGCTATGCCAAAAAGAATATTAATTAATGGTAATGGCATTTCTCATTTCACATGCGGCAAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.40% 15.50% 0.06% 0.00% NA
All Indica  2759 77.30% 22.70% 0.07% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 96.30% 3.70% 0.00% 0.00% NA
Indica II  465 92.50% 7.50% 0.00% 0.00% NA
Indica III  913 53.90% 46.00% 0.11% 0.00% NA
Indica Intermediate  786 81.00% 18.80% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 15.60% 84.40% 0.00% 0.00% NA
Intermediate  90 83.30% 15.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217270732 T -> C LOC_Os02g29140.1 upstream_gene_variant ; 4666.0bp to feature; MODIFIER silent_mutation Average:48.885; most accessible tissue: Callus, score: 94.441 N N N N
vg0217270732 T -> C LOC_Os02g29150.1 downstream_gene_variant ; 1331.0bp to feature; MODIFIER silent_mutation Average:48.885; most accessible tissue: Callus, score: 94.441 N N N N
vg0217270732 T -> C LOC_Os02g29150.2 downstream_gene_variant ; 451.0bp to feature; MODIFIER silent_mutation Average:48.885; most accessible tissue: Callus, score: 94.441 N N N N
vg0217270732 T -> C LOC_Os02g29140-LOC_Os02g29150 intergenic_region ; MODIFIER silent_mutation Average:48.885; most accessible tissue: Callus, score: 94.441 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217270732 3.95E-06 NA mr1089 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217270732 5.98E-06 NA mr1093 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217270732 2.35E-07 NA mr1109 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217270732 1.65E-10 NA mr1129 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217270732 2.34E-07 2.14E-06 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217270732 1.19E-06 NA mr1235 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217270732 1.18E-08 NA mr1251 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217270732 3.00E-07 4.60E-19 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217270732 1.71E-06 NA mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217270732 4.43E-09 NA mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217270732 NA 2.34E-07 mr1377 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217270732 1.25E-07 NA mr1423 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217270732 3.02E-08 NA mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217270732 1.68E-06 NA mr1599 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217270732 1.09E-06 NA mr1089_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217270732 7.17E-06 NA mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217270732 6.72E-06 NA mr1093_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217270732 1.76E-06 NA mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217270732 6.98E-08 NA mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217270732 2.67E-06 NA mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217270732 8.19E-07 NA mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217270732 4.21E-08 NA mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217270732 6.16E-06 1.35E-06 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217270732 3.98E-09 NA mr1255_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217270732 2.66E-07 6.72E-07 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217270732 1.16E-08 NA mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217270732 1.88E-06 NA mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217270732 6.39E-06 NA mr1423_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217270732 9.59E-07 NA mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217270732 3.21E-06 NA mr1599_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251