\
| Variant ID: vg0217270732 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 17270732 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTTTGCCGCATGTGAAATGAGAAATGCCATTACCATTAATTAATATTCTTTTTGGCATAGCTCTGTGTATTATTAGTTCCACAAATATATAAATATATGA[T/C]
ACTAGATTTACAATCACGTTGATAACATTCAAATAAATTATTTTATACCAAATAAAACCTAAGTAATGAGAAAATTCTTTATGTACCCTAATAGTTTGCC
GGCAAACTATTAGGGTACATAAAGAATTTTCTCATTACTTAGGTTTTATTTGGTATAAAATAATTTATTTGAATGTTATCAACGTGATTGTAAATCTAGT[A/G]
TCATATATTTATATATTTGTGGAACTAATAATACACAGAGCTATGCCAAAAAGAATATTAATTAATGGTAATGGCATTTCTCATTTCACATGCGGCAAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.40% | 15.50% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 77.30% | 22.70% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.50% | 7.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 53.90% | 46.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 81.00% | 18.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 15.60% | 84.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 15.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0217270732 | T -> C | LOC_Os02g29140.1 | upstream_gene_variant ; 4666.0bp to feature; MODIFIER | silent_mutation | Average:48.885; most accessible tissue: Callus, score: 94.441 | N | N | N | N |
| vg0217270732 | T -> C | LOC_Os02g29150.1 | downstream_gene_variant ; 1331.0bp to feature; MODIFIER | silent_mutation | Average:48.885; most accessible tissue: Callus, score: 94.441 | N | N | N | N |
| vg0217270732 | T -> C | LOC_Os02g29150.2 | downstream_gene_variant ; 451.0bp to feature; MODIFIER | silent_mutation | Average:48.885; most accessible tissue: Callus, score: 94.441 | N | N | N | N |
| vg0217270732 | T -> C | LOC_Os02g29140-LOC_Os02g29150 | intergenic_region ; MODIFIER | silent_mutation | Average:48.885; most accessible tissue: Callus, score: 94.441 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0217270732 | 3.95E-06 | NA | mr1089 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217270732 | 5.98E-06 | NA | mr1093 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217270732 | 2.35E-07 | NA | mr1109 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217270732 | 1.65E-10 | NA | mr1129 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217270732 | 2.34E-07 | 2.14E-06 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217270732 | 1.19E-06 | NA | mr1235 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217270732 | 1.18E-08 | NA | mr1251 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217270732 | 3.00E-07 | 4.60E-19 | mr1253 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217270732 | 1.71E-06 | NA | mr1255 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217270732 | 4.43E-09 | NA | mr1257 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217270732 | NA | 2.34E-07 | mr1377 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217270732 | 1.25E-07 | NA | mr1423 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217270732 | 3.02E-08 | NA | mr1435 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217270732 | 1.68E-06 | NA | mr1599 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217270732 | 1.09E-06 | NA | mr1089_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217270732 | 7.17E-06 | NA | mr1089_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217270732 | 6.72E-06 | NA | mr1093_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217270732 | 1.76E-06 | NA | mr1109_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217270732 | 6.98E-08 | NA | mr1129_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217270732 | 2.67E-06 | NA | mr1129_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217270732 | 8.19E-07 | NA | mr1251_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217270732 | 4.21E-08 | NA | mr1253_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217270732 | 6.16E-06 | 1.35E-06 | mr1253_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217270732 | 3.98E-09 | NA | mr1255_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217270732 | 2.66E-07 | 6.72E-07 | mr1255_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217270732 | 1.16E-08 | NA | mr1257_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217270732 | 1.88E-06 | NA | mr1257_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217270732 | 6.39E-06 | NA | mr1423_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217270732 | 9.59E-07 | NA | mr1435_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217270732 | 3.21E-06 | NA | mr1599_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |