\
| Variant ID: vg0217266536 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 17266536 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAGACAGTTCAAACGTACACATTCTTGTGTATCAAGTTTCATTAGCCTATATGACATTTTAAATAGAGTTAAACTCAAATAAAACATGCATTGATAATGG[G/A]
ACAATATAAACAGGAAAGCGATGTAAAAATAATAAAAAGCAAAAGTACGAATTAATTAGTTAATTCATAAAAATGCAAAATAGGAAGGGGTTTGATATGG
CCATATCAAACCCCTTCCTATTTTGCATTTTTATGAATTAACTAATTAATTCGTACTTTTGCTTTTTATTATTTTTACATCGCTTTCCTGTTTATATTGT[C/T]
CCATTATCAATGCATGTTTTATTTGAGTTTAACTCTATTTAAAATGTCATATAGGCTAATGAAACTTGATACACAAGAATGTGTACGTTTGAACTGTCTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.40% | 15.60% | 2.77% | 15.26% | NA |
| All Indica | 2759 | 50.60% | 22.80% | 4.64% | 22.04% | NA |
| All Japonica | 1512 | 97.90% | 0.50% | 0.00% | 1.59% | NA |
| Aus | 269 | 69.50% | 1.50% | 0.37% | 28.62% | NA |
| Indica I | 595 | 64.70% | 3.90% | 9.08% | 22.35% | NA |
| Indica II | 465 | 83.00% | 7.70% | 2.15% | 7.10% | NA |
| Indica III | 913 | 20.40% | 46.20% | 2.85% | 30.56% | NA |
| Indica Intermediate | 786 | 55.70% | 18.70% | 4.83% | 20.74% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 95.20% | 0.60% | 0.00% | 4.17% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.10% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 13.50% | 85.40% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 71.10% | 14.40% | 2.22% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0217266536 | G -> A | LOC_Os02g29140.1 | upstream_gene_variant ; 470.0bp to feature; MODIFIER | silent_mutation | Average:62.862; most accessible tissue: Callus, score: 92.518 | N | N | N | N |
| vg0217266536 | G -> A | LOC_Os02g29150.2 | downstream_gene_variant ; 4647.0bp to feature; MODIFIER | silent_mutation | Average:62.862; most accessible tissue: Callus, score: 92.518 | N | N | N | N |
| vg0217266536 | G -> A | LOC_Os02g29140-LOC_Os02g29150 | intergenic_region ; MODIFIER | silent_mutation | Average:62.862; most accessible tissue: Callus, score: 92.518 | N | N | N | N |
| vg0217266536 | G -> DEL | N | N | silent_mutation | Average:62.862; most accessible tissue: Callus, score: 92.518 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0217266536 | 2.43E-07 | NA | mr1109 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | 4.02E-10 | NA | mr1129 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | 4.42E-07 | 2.70E-06 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | 2.32E-06 | NA | mr1235 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | 5.60E-08 | NA | mr1251 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | 2.27E-07 | 6.33E-19 | mr1253 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | 9.39E-06 | NA | mr1255 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | 1.95E-09 | NA | mr1257 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | 7.72E-06 | NA | mr1257 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | NA | 2.35E-07 | mr1377 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | 1.19E-07 | NA | mr1423 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | NA | 8.37E-06 | mr1423 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | 9.44E-08 | NA | mr1435 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | 5.49E-06 | NA | mr1599 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | 1.68E-06 | NA | mr1089_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | 3.82E-06 | NA | mr1093_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | 6.87E-07 | NA | mr1109_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | 8.51E-06 | NA | mr1109_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | 6.44E-08 | NA | mr1129_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | 1.68E-06 | NA | mr1129_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | 2.35E-07 | NA | mr1251_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | 2.45E-06 | NA | mr1251_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | 1.65E-08 | NA | mr1253_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | 2.24E-06 | 2.19E-06 | mr1253_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | 2.90E-08 | NA | mr1255_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | 1.45E-06 | 2.14E-06 | mr1255_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | 1.00E-08 | NA | mr1257_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | 1.49E-06 | NA | mr1257_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | 3.56E-06 | NA | mr1423_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | 2.73E-07 | NA | mr1435_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | 2.90E-06 | NA | mr1435_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217266536 | 2.81E-06 | NA | mr1599_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |