Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217256342:

Variant ID: vg0217256342 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 17256342
Reference Allele: G	Alternative Allele: GAGTCTTACCTAA,A
Primary Allele: G	Secondary Allele: GAGTCTTACCTAA

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

CCTTTGAACTGATCTATAAAATCTGGACACACAAAAATACTCCCTCCGTTCCAATGGGCCCCGTTTAGCACAGCTCTAACTCCCAACTCCAACTTACCTA[G/GAGTCTTACCTAA,A]
AGTTGGAGCTGTGCCAAACGGTACATACTCTATTTTTTGGAGCGGAATTGGTAAAGCTGCGCCACAAATTTGTACTACGGGGGTAGAGCTGGGTTTTTAC

Reverse complement sequence

GTAAAAACCCAGCTCTACCCCCGTAGTACAAATTTGTGGCGCAGCTTTACCAATTCCGCTCCAAAAAATAGAGTATGTACCGTTTGGCACAGCTCCAACT[C/TTAGGTAAGACTC,T]
TAGGTAAGTTGGAGTTGGGAGTTAGAGCTGTGCTAAACGGGGCCCATTGGAACGGAGGGAGTATTTTTGTGTGTCCAGATTTTATAGATCAGTTCAAAGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of GAGTCTTACCTAA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.70%	14.20%	0.06%	0.00%	A: 0.11%
All Indica	2759	82.90%	16.90%	0.07%	0.00%	A: 0.11%
All Japonica	1512	99.60%	0.30%	0.00%	0.00%	A: 0.07%
Aus	269	31.60%	68.00%	0.00%	0.00%	A: 0.37%
Indica I	595	78.70%	21.00%	0.34%	0.00%	NA
Indica II	465	74.20%	25.80%	0.00%	0.00%	NA
Indica III	913	88.60%	11.30%	0.00%	0.00%	A: 0.11%
Indica Intermediate	786	84.60%	15.10%	0.00%	0.00%	A: 0.25%
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.00%	0.80%	0.00%	0.00%	A: 0.20%
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	87.80%	11.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0217256342	G -> A	LOC_Os02g29130.1	upstream_gene_variant ; 1463.0bp to feature; MODIFIER	silent_mutation	Average:57.203; most accessible tissue: Zhenshan97 young leaf, score: 73.923	N	N	N	N
vg0217256342	G -> A	LOC_Os02g29130.2	upstream_gene_variant ; 1463.0bp to feature; MODIFIER	silent_mutation	Average:57.203; most accessible tissue: Zhenshan97 young leaf, score: 73.923	N	N	N	N
vg0217256342	G -> A	LOC_Os02g29140.1	downstream_gene_variant ; 1598.0bp to feature; MODIFIER	silent_mutation	Average:57.203; most accessible tissue: Zhenshan97 young leaf, score: 73.923	N	N	N	N
vg0217256342	G -> A	LOC_Os02g29130-LOC_Os02g29140	intergenic_region ; MODIFIER	silent_mutation	Average:57.203; most accessible tissue: Zhenshan97 young leaf, score: 73.923	N	N	N	N
vg0217256342	G -> GAGTCTTACCTAA	LOC_Os02g29130.1	upstream_gene_variant ; 1464.0bp to feature; MODIFIER	silent_mutation	Average:57.203; most accessible tissue: Zhenshan97 young leaf, score: 73.923	N	N	N	N
vg0217256342	G -> GAGTCTTACCTAA	LOC_Os02g29130.2	upstream_gene_variant ; 1464.0bp to feature; MODIFIER	silent_mutation	Average:57.203; most accessible tissue: Zhenshan97 young leaf, score: 73.923	N	N	N	N
vg0217256342	G -> GAGTCTTACCTAA	LOC_Os02g29140.1	downstream_gene_variant ; 1597.0bp to feature; MODIFIER	silent_mutation	Average:57.203; most accessible tissue: Zhenshan97 young leaf, score: 73.923	N	N	N	N
vg0217256342	G -> GAGTCTTACCTAA	LOC_Os02g29130-LOC_Os02g29140	intergenic_region ; MODIFIER	silent_mutation	Average:57.203; most accessible tissue: Zhenshan97 young leaf, score: 73.923	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0217256342	NA	1.89E-13	mr1317	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217256342	NA	9.31E-11	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217256342	NA	3.51E-06	mr1818	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217256342	1.33E-07	9.28E-32	mr1855	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217256342	4.62E-06	1.62E-22	mr1855	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217256342	NA	2.39E-15	mr1317_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217256342	NA	1.26E-14	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217256342	NA	1.07E-07	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217256342	NA	8.43E-06	mr1610_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217256342	6.33E-06	6.33E-06	mr1630_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217256342	NA	4.29E-06	mr1649_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217256342	NA	4.96E-10	mr1818_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217256342	NA	8.07E-08	mr1818_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217256342	1.08E-06	1.08E-06	mr1848_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217256342	4.68E-08	6.65E-38	mr1855_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217256342	NA	4.36E-23	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217256342	NA	1.61E-14	mr1897_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217256342	NA	9.46E-11	mr1897_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217256342	NA	4.87E-14	mr1914_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217256342	NA	7.64E-12	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217256342	NA	2.08E-11	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251