\
| Variant ID: vg0217228197 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 17228197 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 111. )
CGAAACTATTCATATTATAAATATTATTATATTTGTCTATAAACTTAGTCAAACTAATAGTTTGACTTTAACCAAAGTTATAATATCTTGTAGCTGAAAC[G/A]
GAGGGAGTAGTCTGGAGGATTTATGCACAAGAGGAAAAATTTATACTGCACAGAGGTTCAGCATAACATATCCCGACACCCGACTGTATGCTCCCAATAA
TTATTGGGAGCATACAGTCGGGTGTCGGGATATGTTATGCTGAACCTCTGTGCAGTATAAATTTTTCCTCTTGTGCATAAATCCTCCAGACTACTCCCTC[C/T]
GTTTCAGCTACAAGATATTATAACTTTGGTTAAAGTCAAACTATTAGTTTGACTAAGTTTATAGACAAATATAATAATATTTATAATATGAATAGTTTCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.20% | 33.60% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 53.80% | 45.90% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 1.50% | 98.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 44.70% | 54.80% | 0.50% | 0.00% | NA |
| Indica II | 465 | 62.60% | 37.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 52.40% | 47.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 57.30% | 42.20% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0217228197 | G -> A | LOC_Os02g29090.1 | downstream_gene_variant ; 869.0bp to feature; MODIFIER | silent_mutation | Average:41.786; most accessible tissue: Callus, score: 76.564 | N | N | N | N |
| vg0217228197 | G -> A | LOC_Os02g29090-LOC_Os02g29110 | intergenic_region ; MODIFIER | silent_mutation | Average:41.786; most accessible tissue: Callus, score: 76.564 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0217228197 | 4.00E-10 | NA | mr1089 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 2.18E-13 | 6.99E-13 | mr1089 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 1.69E-07 | NA | mr1093 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 1.62E-09 | 8.38E-09 | mr1093 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | NA | 1.25E-06 | mr1106 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 1.61E-21 | NA | mr1109 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 6.26E-22 | 4.80E-26 | mr1109 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 4.00E-17 | NA | mr1129 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 4.31E-19 | 1.90E-25 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | NA | 7.56E-06 | mr1229 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 1.56E-11 | NA | mr1235 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 7.39E-12 | 7.45E-12 | mr1235 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | NA | 8.41E-08 | mr1236 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 3.95E-08 | 1.18E-13 | mr1236 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 1.93E-07 | NA | mr1243 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 3.27E-08 | 8.22E-08 | mr1243 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 4.41E-17 | NA | mr1251 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 7.70E-16 | 4.28E-23 | mr1251 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 2.17E-15 | NA | mr1253 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 1.71E-14 | 4.32E-15 | mr1253 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 2.34E-19 | NA | mr1255 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 5.06E-18 | 4.17E-24 | mr1255 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 3.86E-18 | NA | mr1257 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 9.19E-19 | 4.50E-25 | mr1257 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | NA | 3.75E-07 | mr1317 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 4.94E-13 | NA | mr1423 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 6.09E-15 | 2.07E-16 | mr1423 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 8.28E-17 | NA | mr1435 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 3.38E-17 | 1.22E-22 | mr1435 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 1.28E-12 | NA | mr1599 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 1.32E-13 | 7.60E-16 | mr1599 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 1.15E-08 | 1.79E-35 | mr1855 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 9.51E-06 | 1.05E-15 | mr1855 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | NA | 3.04E-07 | mr1901 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | NA | 2.39E-11 | mr1902 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 5.14E-06 | 5.14E-06 | mr1947 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 4.12E-09 | NA | mr1089_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 5.87E-13 | 3.34E-14 | mr1089_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 1.47E-07 | 4.81E-09 | mr1093_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 5.59E-18 | NA | mr1109_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 4.07E-19 | 7.30E-27 | mr1109_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 1.94E-17 | NA | mr1129_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 1.30E-21 | 6.24E-35 | mr1129_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | NA | 1.97E-06 | mr1198_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | NA | 1.81E-07 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | NA | 1.60E-06 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 5.34E-07 | 3.50E-09 | mr1229_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 1.87E-06 | NA | mr1235_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 7.48E-08 | 9.92E-10 | mr1235_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 2.25E-07 | 2.59E-12 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 1.84E-10 | 1.39E-18 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 3.73E-06 | NA | mr1248_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 5.77E-08 | 2.73E-10 | mr1248_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 2.16E-11 | NA | mr1251_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 1.38E-15 | 2.78E-21 | mr1251_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 5.10E-14 | NA | mr1253_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 3.90E-14 | 2.39E-15 | mr1253_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 1.16E-17 | NA | mr1255_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 4.71E-19 | 1.56E-29 | mr1255_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 3.22E-16 | NA | mr1257_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 2.66E-18 | 2.81E-31 | mr1257_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | NA | 1.03E-10 | mr1317_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | NA | 4.18E-10 | mr1317_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 2.90E-06 | NA | mr1377_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 2.24E-06 | 5.87E-12 | mr1377_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 7.39E-08 | NA | mr1423_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 5.53E-10 | 1.29E-11 | mr1423_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 1.75E-11 | NA | mr1435_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 8.42E-16 | 1.58E-21 | mr1435_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | NA | 1.57E-07 | mr1597_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 4.76E-07 | 1.80E-09 | mr1597_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 9.03E-11 | NA | mr1599_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 3.04E-13 | 2.03E-16 | mr1599_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | NA | 2.70E-06 | mr1713_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | NA | 1.66E-10 | mr1739_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | NA | 7.33E-06 | mr1763_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | NA | 1.26E-13 | mr1818_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | NA | 1.07E-07 | mr1818_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 8.87E-13 | 1.01E-47 | mr1855_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 3.95E-09 | 5.35E-21 | mr1855_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 8.23E-06 | 6.81E-07 | mr1863_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | NA | 3.17E-23 | mr1874_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | NA | 1.60E-07 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | 2.44E-07 | 7.37E-10 | mr1880_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | NA | 3.01E-16 | mr1897_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | NA | 2.61E-07 | mr1897_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | NA | 4.63E-09 | mr1914_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217228197 | NA | 4.32E-08 | mr1927_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |