\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217221174:

Variant ID: vg0217221174 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17221174
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCGAGTTCGAGTCCGGGTCTGTTTTTGTCGGATCTTGGGTTTCCTTGCTCGGGAAGACATGTTTCGGGTTTTTTTTGGATTCTACCCTGAGTTAGACGT[A/G]
GAGGAGGGCCTGTAGAAGGCCAGACCAACCACTATATAAGGGGGTAAGGCCGGTTCATTGTAATAATCAATCTACAATCAATCAATCGAATCATTTTTCA

Reverse complement sequence

TGAAAAATGATTCGATTGATTGATTGTAGATTGATTATTACAATGAACCGGCCTTACCCCCTTATATAGTGGTTGGTCTGGCCTTCTACAGGCCCTCCTC[T/C]
ACGTCTAACTCAGGGTAGAATCCAAAAAAAACCCGAAACATGTCTTCCCGAGCAAGGAAACCCAAGATCCGACAAAAACAGACCCGGACTCGAACTCGGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.10% 5.50% 0.40% 0.00% NA
All Indica  2759 98.70% 1.30% 0.00% 0.00% NA
All Japonica  1512 90.10% 8.60% 1.26% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 97.00% 3.00% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.90% 0.00% 0.00% NA
Temperate Japonica  767 85.10% 12.50% 2.35% 0.00% NA
Tropical Japonica  504 99.20% 0.60% 0.20% 0.00% NA
Japonica Intermediate  241 87.10% 12.90% 0.00% 0.00% NA
VI/Aromatic  96 17.70% 82.30% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217221174 A -> G LOC_Os02g29090.1 upstream_gene_variant ; 2440.0bp to feature; MODIFIER silent_mutation Average:60.46; most accessible tissue: Minghui63 young leaf, score: 69.4 N N N N
vg0217221174 A -> G LOC_Os02g29070.1 downstream_gene_variant ; 2711.0bp to feature; MODIFIER silent_mutation Average:60.46; most accessible tissue: Minghui63 young leaf, score: 69.4 N N N N
vg0217221174 A -> G LOC_Os02g29080.1 downstream_gene_variant ; 385.0bp to feature; MODIFIER silent_mutation Average:60.46; most accessible tissue: Minghui63 young leaf, score: 69.4 N N N N
vg0217221174 A -> G LOC_Os02g29080-LOC_Os02g29090 intergenic_region ; MODIFIER silent_mutation Average:60.46; most accessible tissue: Minghui63 young leaf, score: 69.4 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217221174 1.26E-06 1.26E-06 mr1317 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174 NA 8.11E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174 1.30E-08 2.09E-10 mr1897 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174 7.10E-06 7.10E-06 mr1914 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174 4.92E-06 4.92E-06 mr1927 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174 NA 8.55E-10 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174 1.25E-07 NA mr1317_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174 1.64E-10 1.64E-10 mr1317_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174 NA 2.99E-06 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174 NA 4.15E-06 mr1544_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174 NA 6.16E-10 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174 1.31E-06 1.31E-06 mr1608_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174 3.40E-06 3.40E-06 mr1610_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174 1.77E-07 NA mr1897_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174 4.72E-10 4.72E-10 mr1897_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174 1.68E-07 NA mr1914_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174 4.53E-10 4.53E-10 mr1914_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174 6.29E-10 6.29E-10 mr1927_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251