Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217221174:

Variant ID: vg0217221174 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 17221174
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCCGAGTTCGAGTCCGGGTCTGTTTTTGTCGGATCTTGGGTTTCCTTGCTCGGGAAGACATGTTTCGGGTTTTTTTTGGATTCTACCCTGAGTTAGACGT[A/G]
GAGGAGGGCCTGTAGAAGGCCAGACCAACCACTATATAAGGGGGTAAGGCCGGTTCATTGTAATAATCAATCTACAATCAATCAATCGAATCATTTTTCA

Reverse complement sequence

TGAAAAATGATTCGATTGATTGATTGTAGATTGATTATTACAATGAACCGGCCTTACCCCCTTATATAGTGGTTGGTCTGGCCTTCTACAGGCCCTCCTC[T/C]
ACGTCTAACTCAGGGTAGAATCCAAAAAAAACCCGAAACATGTCTTCCCGAGCAAGGAAACCCAAGATCCGACAAAAACAGACCCGGACTCGAACTCGGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.10%	5.50%	0.40%	0.00%	NA
All Indica	2759	98.70%	1.30%	0.00%	0.00%	NA
All Japonica	1512	90.10%	8.60%	1.26%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	97.00%	3.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.10%	0.90%	0.00%	0.00%	NA
Temperate Japonica	767	85.10%	12.50%	2.35%	0.00%	NA
Tropical Japonica	504	99.20%	0.60%	0.20%	0.00%	NA
Japonica Intermediate	241	87.10%	12.90%	0.00%	0.00%	NA
VI/Aromatic	96	17.70%	82.30%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0217221174	A -> G	LOC_Os02g29090.1	upstream_gene_variant ; 2440.0bp to feature; MODIFIER	silent_mutation	Average:60.46; most accessible tissue: Minghui63 young leaf, score: 69.4	N	N	N	N
vg0217221174	A -> G	LOC_Os02g29070.1	downstream_gene_variant ; 2711.0bp to feature; MODIFIER	silent_mutation	Average:60.46; most accessible tissue: Minghui63 young leaf, score: 69.4	N	N	N	N
vg0217221174	A -> G	LOC_Os02g29080.1	downstream_gene_variant ; 385.0bp to feature; MODIFIER	silent_mutation	Average:60.46; most accessible tissue: Minghui63 young leaf, score: 69.4	N	N	N	N
vg0217221174	A -> G	LOC_Os02g29080-LOC_Os02g29090	intergenic_region ; MODIFIER	silent_mutation	Average:60.46; most accessible tissue: Minghui63 young leaf, score: 69.4	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0217221174	1.26E-06	1.26E-06	mr1317	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174	NA	8.11E-06	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174	1.30E-08	2.09E-10	mr1897	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174	7.10E-06	7.10E-06	mr1914	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174	4.92E-06	4.92E-06	mr1927	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174	NA	8.55E-10	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174	1.25E-07	NA	mr1317_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174	1.64E-10	1.64E-10	mr1317_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174	NA	2.99E-06	mr1456_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174	NA	4.15E-06	mr1544_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174	NA	6.16E-10	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174	1.31E-06	1.31E-06	mr1608_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174	3.40E-06	3.40E-06	mr1610_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174	1.77E-07	NA	mr1897_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174	4.72E-10	4.72E-10	mr1897_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174	1.68E-07	NA	mr1914_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174	4.53E-10	4.53E-10	mr1914_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217221174	6.29E-10	6.29E-10	mr1927_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251