\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217130932:

Variant ID: vg0217130932 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17130932
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAACAATGACGGTTCTGTCCACCATCCATTGTGATCCCAAGACTAGCTTCCCGCCATTGAGTCATCATGGTTTTCTGAGGACGTCCATCTTCCCTTCTCT[C/T]
GAAAAGTGGCTCCAACAGCATAAAATCATCATGCAATAACCTATCCCACACAAATTAAGAATTTAGAGTCTAGCCAAGTGTAATACACGTCTCGGTGCTC

Reverse complement sequence

GAGCACCGAGACGTGTATTACACTTGGCTAGACTCTAAATTCTTAATTTGTGTGGGATAGGTTATTGCATGATGATTTTATGCTGTTGGAGCCACTTTTC[G/A]
AGAGAAGGGAAGATGGACGTCCTCAGAAAACCATGATGACTCAATGGCGGGAAGCTAGTCTTGGGATCACAATGGATGGTGGACAGAACCGTCATTGTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.00% 0.20% 12.74% 31.04% NA
All Indica  2759 36.60% 0.30% 17.83% 45.31% NA
All Japonica  1512 98.50% 0.00% 0.46% 0.99% NA
Aus  269 30.90% 0.40% 11.15% 57.62% NA
Indica I  595 37.00% 0.30% 15.80% 46.89% NA
Indica II  465 27.30% 0.20% 17.42% 55.05% NA
Indica III  913 42.70% 0.20% 18.18% 38.88% NA
Indica Intermediate  786 34.60% 0.40% 19.21% 45.80% NA
Temperate Japonica  767 99.20% 0.00% 0.26% 0.52% NA
Tropical Japonica  504 98.40% 0.00% 0.40% 1.19% NA
Japonica Intermediate  241 96.70% 0.00% 1.24% 2.07% NA
VI/Aromatic  96 11.50% 0.00% 64.58% 23.96% NA
Intermediate  90 61.10% 0.00% 12.22% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217130932 C -> T LOC_Os02g28920.1 upstream_gene_variant ; 995.0bp to feature; MODIFIER silent_mutation Average:33.859; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg0217130932 C -> T LOC_Os02g28930.1 upstream_gene_variant ; 1605.0bp to feature; MODIFIER silent_mutation Average:33.859; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg0217130932 C -> T LOC_Os02g28940.1 downstream_gene_variant ; 2732.0bp to feature; MODIFIER silent_mutation Average:33.859; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg0217130932 C -> T LOC_Os02g28950.1 downstream_gene_variant ; 4104.0bp to feature; MODIFIER silent_mutation Average:33.859; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg0217130932 C -> T LOC_Os02g28920-LOC_Os02g28930 intergenic_region ; MODIFIER silent_mutation Average:33.859; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg0217130932 C -> DEL N N silent_mutation Average:33.859; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217130932 NA 5.80E-06 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 NA 1.05E-08 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 NA 2.94E-10 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 3.94E-06 NA mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 5.78E-06 3.26E-07 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 NA 2.24E-06 mr1253 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 4.33E-06 NA mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 1.80E-06 1.65E-09 mr1255 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 7.81E-06 3.58E-07 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 2.80E-12 1.42E-23 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 3.75E-09 3.84E-20 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 9.12E-06 4.01E-07 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 NA 8.46E-07 mr1585 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 1.03E-06 NA mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 NA 2.54E-06 mr1610 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 NA 8.16E-10 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 3.58E-18 2.46E-75 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 1.19E-09 9.11E-37 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 2.07E-07 4.83E-18 mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 NA 2.41E-08 mr1897 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 5.63E-09 2.05E-12 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 2.81E-06 5.84E-11 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 1.17E-09 2.46E-14 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 8.73E-08 2.36E-11 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 NA 2.59E-10 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 NA 6.80E-13 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 NA 2.38E-08 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 NA 1.60E-08 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 NA 5.87E-10 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 NA 4.99E-10 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 9.98E-12 7.08E-29 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 7.11E-08 1.25E-24 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 NA 1.90E-08 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 6.21E-06 1.40E-15 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 NA 2.03E-10 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 6.58E-08 1.80E-19 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 3.29E-06 1.62E-14 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 3.54E-09 1.31E-26 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 5.62E-07 4.50E-16 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 5.04E-21 1.16E-94 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 6.08E-10 1.99E-41 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 1.73E-10 6.90E-29 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 5.49E-07 3.54E-18 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 1.54E-10 1.88E-31 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 NA 1.80E-23 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 8.46E-11 2.46E-32 mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217130932 NA 5.80E-22 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251