\
| Variant ID: vg0217111661 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 17111661 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.16, others allele: 0.00, population size: 103. )
CATGAGACACGTCACGGCAAAGCTTTTCGATAACCTCGCATTGGCAGTACCCGCTCCATGAAGTTAAATCCTCATGCACTCTAGGCGTCCATGTTTCTAG[T/C]
AGTGAGAGGAGTTCTGGCGCTCCCGGGAAAGAGAAGTCTTACACACATATTAAATTATGGTTCAAGTTAAGTTCTCTCTCTCACACACTCATGGCAGTCC
GGACTGCCATGAGTGTGTGAGAGAGAGAACTTAACTTGAACCATAATTTAATATGTGTGTAAGACTTCTCTTTCCCGGGAGCGCCAGAACTCCTCTCACT[A/G]
CTAGAAACATGGACGCCTAGAGTGCATGAGGATTTAACTTCATGGAGCGGGTACTGCCAATGCGAGGTTATCGAAAAGCTTTGCCGTGACGTGTCTCATG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.50% | 28.20% | 12.17% | 2.14% | NA |
| All Indica | 2759 | 78.10% | 4.70% | 14.39% | 2.83% | NA |
| All Japonica | 1512 | 22.30% | 77.20% | 0.46% | 0.07% | NA |
| Aus | 269 | 33.50% | 0.40% | 58.74% | 7.43% | NA |
| Indica I | 595 | 77.10% | 0.70% | 16.13% | 6.05% | NA |
| Indica II | 465 | 63.40% | 10.10% | 20.43% | 6.02% | NA |
| Indica III | 913 | 83.10% | 5.80% | 10.95% | 0.11% | NA |
| Indica Intermediate | 786 | 81.70% | 3.20% | 13.49% | 1.65% | NA |
| Temperate Japonica | 767 | 18.80% | 81.00% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 26.20% | 73.00% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 25.30% | 73.90% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 87.50% | 8.30% | 3.12% | 1.04% | NA |
| Intermediate | 90 | 57.80% | 30.00% | 11.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0217111661 | T -> DEL | N | N | silent_mutation | Average:52.016; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg0217111661 | T -> C | LOC_Os02g28890.1 | upstream_gene_variant ; 1199.0bp to feature; MODIFIER | silent_mutation | Average:52.016; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg0217111661 | T -> C | LOC_Os02g28890-LOC_Os02g28900 | intergenic_region ; MODIFIER | silent_mutation | Average:52.016; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0217111661 | NA | 3.86E-41 | mr1093 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217111661 | NA | 2.03E-06 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217111661 | NA | 6.00E-29 | mr1423 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217111661 | NA | 8.02E-29 | mr1546 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217111661 | NA | 6.24E-06 | mr1897 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217111661 | 1.27E-06 | NA | mr1064_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217111661 | NA | 1.46E-07 | mr1399_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217111661 | NA | 1.20E-07 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217111661 | NA | 2.59E-06 | mr1687_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217111661 | NA | 2.52E-13 | mr1838_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217111661 | 9.51E-07 | 1.82E-10 | mr1897_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217111661 | 5.04E-07 | 5.04E-07 | mr1897_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217111661 | 2.55E-06 | NA | mr1914_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217111661 | 8.97E-06 | 8.97E-06 | mr1914_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |