RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0217102196:

Variant ID: vg0217102196 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 17102196
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 130. )

Flanking Sequence (100 bp) in Reference Genome:

AATTAATGTCAATAGTAAATTATTGAACTAGGACAAATTTAGTGGTACATAGTAAATTTTCTCCAAAATAATTTTTGGGTAAAACTTCCATATACGTGTC[C/T]
TTAGAGATTCAAAAGCAAATGGTGTGAAATAAACTATGATAAGAAAAACCATAAAATCAAATCTAAATTAAGTGTTGAAATTTAAATTTTGGCTTATAAA

Reverse complement sequence

TTTATAAGCCAAAATTTAAATTTCAACACTTAATTTAGATTTGATTTTATGGTTTTTCTTATCATAGTTTATTTCACACCATTTGCTTTTGAATCTCTAA[G/A]
GACACGTATATGGAAGTTTTACCCAAAAATTATTTTGGAGAAAATTTACTATGTACCACTAAATTTGTCCTAGTTCAATAATTTACTATTGACATTAATT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.10%	14.70%	0.17%	0.00%	NA
All Indica	2759	81.80%	18.00%	0.25%	0.00%	NA
All Japonica	1512	99.60%	0.30%	0.07%	0.00%	NA
Aus	269	31.60%	68.40%	0.00%	0.00%	NA
Indica I	595	77.50%	22.20%	0.34%	0.00%	NA
Indica II	465	72.30%	27.50%	0.22%	0.00%	NA
Indica III	913	88.00%	11.90%	0.11%	0.00%	NA
Indica Intermediate	786	83.50%	16.20%	0.38%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	0.80%	0.41%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0217102196	C -> T	LOC_Os02g28880-LOC_Os02g28890	intergenic_region ; MODIFIER	silent_mutation	Average:29.662; most accessible tissue: Callus, score: 56.203	N	N	N	N

Showing 1 to 1 of 1 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0217102196	NA	1.92E-09	mr1109	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217102196	5.24E-07	NA	mr1129	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217102196	NA	1.76E-10	mr1129	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217102196	NA	1.88E-06	mr1251	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217102196	NA	7.43E-07	mr1255	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217102196	NA	1.99E-06	mr1257	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217102196	1.46E-25	4.99E-41	mr1317	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217102196	1.70E-21	6.88E-39	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217102196	3.22E-07	6.73E-10	mr1350	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217102196	NA	3.29E-06	mr1409	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 61 entries

Previous1 2 3 4 5 6 7Next

Search for Variation information by Variation ID:

Detailed information for vg0217102196:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact