\
| Variant ID: vg0217086084 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 17086084 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.06, others allele: 0.00, population size: 232. )
CGACGAGGAGGCGGCGTCCGCGGTGATGGAGCAGGCGATGACCGGCCTCATGGACCTCACCTACCGCAAAGCGAAGCCTCCAGAGCTGCCTTACGAGTTC[G/A]
CCACAAGATGGCCTATTCCTATTGCTCATGTAAGTGCCTGCTCCTTGGTCTCTTGACTCTGAATTCTTGGCATTTCTTGTCGAGGCTTCCAGCTCTGTTC
GAACAGAGCTGGAAGCCTCGACAAGAAATGCCAAGAATTCAGAGTCAAGAGACCAAGGAGCAGGCACTTACATGAGCAATAGGAATAGGCCATCTTGTGG[C/T]
GAACTCGTAAGGCAGCTCTGGAGGCTTCGCTTTGCGGTAGGTGAGGTCCATGAGGCCGGTCATCGCCTGCTCCATCACCGCGGACGCCGCCTCCTCGTCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.60% | 46.30% | 0.11% | 0.06% | NA |
| All Indica | 2759 | 76.70% | 23.10% | 0.18% | 0.11% | NA |
| All Japonica | 1512 | 13.00% | 87.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 31.60% | 68.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 75.80% | 23.50% | 0.50% | 0.17% | NA |
| Indica II | 465 | 61.90% | 37.80% | 0.00% | 0.22% | NA |
| Indica III | 913 | 82.10% | 17.60% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 79.60% | 20.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 3.90% | 96.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 26.40% | 73.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 14.10% | 85.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 44.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0217086084 | G -> A | LOC_Os02g28870.1 | missense_variant ; p.Ala178Thr; MODERATE | nonsynonymous_codon ; A178T | Average:64.164; most accessible tissue: Minghui63 root, score: 74.461 | unknown | unknown | DELETERIOUS | 0.00 |
| vg0217086084 | G -> DEL | LOC_Os02g28870.1 | N | frameshift_variant | Average:64.164; most accessible tissue: Minghui63 root, score: 74.461 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0217086084 | 2.92E-06 | 3.31E-11 | mr1055 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 1.13E-09 | 1.51E-48 | mr1089 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 1.98E-07 | 5.70E-11 | mr1089 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 1.71E-09 | 3.44E-47 | mr1093 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | NA | 2.56E-09 | mr1093 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 1.60E-08 | 4.94E-48 | mr1109 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 1.10E-06 | 2.95E-15 | mr1109 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 7.35E-12 | 3.13E-52 | mr1129 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 5.60E-08 | 2.75E-16 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 2.84E-10 | 6.51E-47 | mr1235 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 2.42E-07 | 1.10E-10 | mr1235 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 1.20E-06 | 6.60E-38 | mr1251 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | NA | 1.07E-08 | mr1251 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 3.57E-06 | 2.16E-26 | mr1253 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | NA | 2.14E-08 | mr1253 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 2.16E-06 | 9.20E-27 | mr1255 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | NA | 1.24E-08 | mr1255 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 1.71E-07 | 3.89E-40 | mr1257 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | NA | 1.74E-10 | mr1257 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | NA | 9.84E-06 | mr1308 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 2.04E-20 | 3.81E-35 | mr1317 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 6.46E-16 | 6.25E-26 | mr1317 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 1.26E-06 | NA | mr1350 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 6.53E-09 | 1.04E-12 | mr1350 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | NA | 2.26E-06 | mr1377 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 1.34E-06 | 1.19E-31 | mr1423 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | NA | 3.20E-06 | mr1423 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | NA | 2.82E-08 | mr1423 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 3.95E-09 | 4.28E-48 | mr1435 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | NA | 1.91E-10 | mr1435 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 5.89E-06 | 4.26E-10 | mr1585 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 2.49E-08 | NA | mr1599 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 8.78E-07 | 8.68E-12 | mr1599 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 3.24E-06 | 1.97E-09 | mr1603 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 8.00E-06 | 3.42E-06 | mr1603 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | NA | 7.87E-09 | mr1608 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 3.29E-11 | 8.51E-19 | mr1610 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 8.75E-10 | 4.08E-12 | mr1610 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | NA | 4.78E-06 | mr1649 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | NA | 9.53E-15 | mr1807 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 5.37E-08 | 5.26E-12 | mr1818 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 2.74E-24 | 4.22E-26 | mr1855 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 4.18E-27 | 5.97E-57 | mr1855 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 5.35E-09 | NA | mr1897 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 1.57E-07 | 2.50E-08 | mr1897 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 2.54E-11 | 3.95E-25 | mr1914 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 7.55E-12 | 5.20E-16 | mr1914 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 1.20E-09 | 2.90E-21 | mr1927 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 3.61E-10 | 1.38E-14 | mr1927 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 9.53E-10 | 2.02E-54 | mr1089_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 4.54E-08 | 6.83E-15 | mr1089_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 1.25E-07 | NA | mr1093_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 3.59E-06 | 2.13E-12 | mr1093_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 5.79E-06 | NA | mr1109_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 1.77E-06 | 5.82E-19 | mr1109_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 3.45E-10 | 8.04E-54 | mr1129_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 8.43E-11 | 9.37E-22 | mr1129_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 5.71E-06 | NA | mr1235_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | NA | 3.24E-10 | mr1235_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | NA | 6.02E-07 | mr1243_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | NA | 7.86E-19 | mr1248_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 1.79E-07 | 7.34E-12 | mr1248_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | NA | 1.04E-07 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 5.27E-09 | 3.35E-50 | mr1251_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 6.12E-08 | 5.27E-16 | mr1251_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 5.64E-07 | 1.26E-31 | mr1253_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 3.14E-08 | 1.66E-13 | mr1253_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 2.05E-08 | 1.27E-32 | mr1255_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 1.70E-08 | 1.84E-15 | mr1255_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 1.41E-10 | 1.34E-52 | mr1257_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 1.03E-09 | 1.90E-20 | mr1257_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 8.47E-20 | 6.56E-33 | mr1317_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 1.77E-21 | 1.41E-37 | mr1317_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | NA | 3.41E-15 | mr1377_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | NA | 6.17E-08 | mr1377_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | NA | 1.59E-07 | mr1423_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 7.26E-09 | 4.78E-50 | mr1435_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 8.26E-08 | 7.95E-16 | mr1435_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | NA | 7.89E-07 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | NA | 1.60E-07 | mr1577_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 6.96E-08 | 5.06E-10 | mr1585_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | NA | 4.68E-08 | mr1587_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 7.50E-09 | NA | mr1599_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 8.65E-07 | 7.85E-16 | mr1599_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | NA | 2.05E-07 | mr1603_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 1.31E-11 | 7.41E-13 | mr1608_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 2.07E-09 | 7.48E-12 | mr1608_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 4.70E-14 | 7.43E-24 | mr1610_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 7.25E-15 | 8.21E-26 | mr1610_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | NA | 1.08E-06 | mr1632_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | NA | 5.11E-07 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | NA | 6.61E-08 | mr1792_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 1.01E-14 | 3.42E-15 | mr1818_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 2.01E-17 | 1.33E-25 | mr1818_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 1.02E-26 | 2.14E-28 | mr1855_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 6.71E-29 | 4.53E-65 | mr1855_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 6.17E-15 | 1.98E-10 | mr1897_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 8.60E-20 | 1.96E-27 | mr1897_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 3.88E-17 | 7.62E-37 | mr1914_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 7.28E-18 | 4.17E-43 | mr1914_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 6.85E-18 | 1.87E-34 | mr1927_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217086084 | 1.24E-21 | 4.28E-40 | mr1927_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |