\
| Variant ID: vg0217073423 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 17073423 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.09, others allele: 0.00, population size: 58. )
TTTGGTTCAATACCCTATCAAAATATTGGTAGTGCCAAAACCTAGGCAAGTTTTGGTACTACCAATTTTTTTGGTAGGGTAGAGTTATATTTGGTTTGAG[A/G]
CCAATTTAGAACCAAGCATTGAGTAGAATATAGAAAATATCAAATTGGGCATTGGCAATGCCAATGATTTGGCTTCAAACCAAAATCACCAGATACACTG
CAGTGTATCTGGTGATTTTGGTTTGAAGCCAAATCATTGGCATTGCCAATGCCCAATTTGATATTTTCTATATTCTACTCAATGCTTGGTTCTAAATTGG[T/C]
CTCAAACCAAATATAACTCTACCCTACCAAAAAAATTGGTAGTACCAAAACTTGCCTAGGTTTTGGCACTACCAATATTTTGATAGGGTATTGAACCAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 28.00% | 3.30% | 0.85% | 67.92% | NA |
| All Indica | 2759 | 5.30% | 0.00% | 0.47% | 94.16% | NA |
| All Japonica | 1512 | 75.20% | 10.00% | 1.52% | 13.29% | NA |
| Aus | 269 | 0.40% | 0.00% | 0.00% | 99.63% | NA |
| Indica I | 595 | 1.20% | 0.00% | 0.84% | 97.98% | NA |
| Indica II | 465 | 10.80% | 0.00% | 0.43% | 88.82% | NA |
| Indica III | 913 | 6.70% | 0.00% | 0.22% | 93.10% | NA |
| Indica Intermediate | 786 | 3.70% | 0.10% | 0.51% | 95.67% | NA |
| Temperate Japonica | 767 | 77.30% | 16.20% | 2.61% | 3.91% | NA |
| Tropical Japonica | 504 | 73.00% | 0.00% | 0.00% | 26.98% | NA |
| Japonica Intermediate | 241 | 73.00% | 11.20% | 1.24% | 14.52% | NA |
| VI/Aromatic | 96 | 8.30% | 0.00% | 0.00% | 91.67% | NA |
| Intermediate | 90 | 31.10% | 3.30% | 4.44% | 61.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0217073423 | A -> G | LOC_Os02g28850.1 | upstream_gene_variant ; 778.0bp to feature; MODIFIER | silent_mutation | Average:49.552; most accessible tissue: Minghui63 root, score: 64.607 | N | N | N | N |
| vg0217073423 | A -> G | LOC_Os02g28840-LOC_Os02g28850 | intergenic_region ; MODIFIER | silent_mutation | Average:49.552; most accessible tissue: Minghui63 root, score: 64.607 | N | N | N | N |
| vg0217073423 | A -> DEL | N | N | silent_mutation | Average:49.552; most accessible tissue: Minghui63 root, score: 64.607 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0217073423 | 1.38E-07 | 1.38E-07 | mr1317 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217073423 | 3.06E-06 | 3.06E-06 | mr1608 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217073423 | 1.05E-10 | 8.72E-12 | mr1897 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217073423 | 1.68E-06 | 1.68E-06 | mr1927 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217073423 | 1.45E-12 | 1.45E-12 | mr1317_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217073423 | NA | 2.39E-07 | mr1456_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217073423 | 1.09E-07 | 1.09E-07 | mr1608_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217073423 | 6.15E-06 | 6.16E-06 | mr1610_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217073423 | NA | 3.23E-06 | mr1792_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217073423 | 7.60E-13 | 7.60E-13 | mr1897_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217073423 | 3.01E-12 | 3.01E-12 | mr1914_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217073423 | 1.20E-10 | 1.20E-10 | mr1927_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |