\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217073423:

Variant ID: vg0217073423 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17073423
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.09, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGGTTCAATACCCTATCAAAATATTGGTAGTGCCAAAACCTAGGCAAGTTTTGGTACTACCAATTTTTTTGGTAGGGTAGAGTTATATTTGGTTTGAG[A/G]
CCAATTTAGAACCAAGCATTGAGTAGAATATAGAAAATATCAAATTGGGCATTGGCAATGCCAATGATTTGGCTTCAAACCAAAATCACCAGATACACTG

Reverse complement sequence

CAGTGTATCTGGTGATTTTGGTTTGAAGCCAAATCATTGGCATTGCCAATGCCCAATTTGATATTTTCTATATTCTACTCAATGCTTGGTTCTAAATTGG[T/C]
CTCAAACCAAATATAACTCTACCCTACCAAAAAAATTGGTAGTACCAAAACTTGCCTAGGTTTTGGCACTACCAATATTTTGATAGGGTATTGAACCAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.00% 3.30% 0.85% 67.92% NA
All Indica  2759 5.30% 0.00% 0.47% 94.16% NA
All Japonica  1512 75.20% 10.00% 1.52% 13.29% NA
Aus  269 0.40% 0.00% 0.00% 99.63% NA
Indica I  595 1.20% 0.00% 0.84% 97.98% NA
Indica II  465 10.80% 0.00% 0.43% 88.82% NA
Indica III  913 6.70% 0.00% 0.22% 93.10% NA
Indica Intermediate  786 3.70% 0.10% 0.51% 95.67% NA
Temperate Japonica  767 77.30% 16.20% 2.61% 3.91% NA
Tropical Japonica  504 73.00% 0.00% 0.00% 26.98% NA
Japonica Intermediate  241 73.00% 11.20% 1.24% 14.52% NA
VI/Aromatic  96 8.30% 0.00% 0.00% 91.67% NA
Intermediate  90 31.10% 3.30% 4.44% 61.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217073423 A -> G LOC_Os02g28850.1 upstream_gene_variant ; 778.0bp to feature; MODIFIER silent_mutation Average:49.552; most accessible tissue: Minghui63 root, score: 64.607 N N N N
vg0217073423 A -> G LOC_Os02g28840-LOC_Os02g28850 intergenic_region ; MODIFIER silent_mutation Average:49.552; most accessible tissue: Minghui63 root, score: 64.607 N N N N
vg0217073423 A -> DEL N N silent_mutation Average:49.552; most accessible tissue: Minghui63 root, score: 64.607 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217073423 1.38E-07 1.38E-07 mr1317 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217073423 3.06E-06 3.06E-06 mr1608 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217073423 1.05E-10 8.72E-12 mr1897 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217073423 1.68E-06 1.68E-06 mr1927 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217073423 1.45E-12 1.45E-12 mr1317_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217073423 NA 2.39E-07 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217073423 1.09E-07 1.09E-07 mr1608_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217073423 6.15E-06 6.16E-06 mr1610_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217073423 NA 3.23E-06 mr1792_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217073423 7.60E-13 7.60E-13 mr1897_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217073423 3.01E-12 3.01E-12 mr1914_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217073423 1.20E-10 1.20E-10 mr1927_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251