Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217061679:

Variant ID: vg0217061679 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17061679
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


CACCCGCTAATCATTGCTCCGTTTTCCGTGCCAGGGAGTGAGGGTTCCCAACCCTTACTCCCGAACGCAGCCTTAGATCTATAAATTTGGTTTATTTTAA[A/T]
TCATGTACCATCAAGTATTCCAATCATATTGCTTGCATATATGGATGTGATTCAATCGAGGAGGTGATTAATCTTTTCTTGGTTTTTGTGTTAGAAGTGG

Reverse complement sequence

CCACTTCTAACACAAAAACCAAGAAAAGATTAATCACCTCCTCGATTGAATCACATCCATATATGCAAGCAATATGATTGGAATACTTGATGGTACATGA[T/A]
TTAAAATAAACCAAATTTATAGATCTAAGGCTGCGTTCGGGAGTAAGGGTTGGGAACCCTCACTCCCTGGCACGGAAAACGGAGCAATGATTAGCGGGTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.10% 30.90% 0.00% 0.00% NA
All Indica  2759 95.70% 4.30% 0.00% 0.00% NA
All Japonica  1512 13.50% 86.50% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 90.30% 9.70% 0.00% 0.00% NA
Indica III  913 94.50% 5.50% 0.00% 0.00% NA
Indica Intermediate  786 97.10% 2.90% 0.00% 0.00% NA
Temperate Japonica  767 4.20% 95.80% 0.00% 0.00% NA
Tropical Japonica  504 27.20% 72.80% 0.00% 0.00% NA
Japonica Intermediate  241 14.50% 85.50% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217061679 A -> T LOC_Os02g28840.1 upstream_gene_variant ; 1705.0bp to feature; MODIFIER silent_mutation Average:39.013; most accessible tissue: Minghui63 flower, score: 52.791 N N N N
vg0217061679 A -> T LOC_Os02g28830-LOC_Os02g28840 intergenic_region ; MODIFIER silent_mutation Average:39.013; most accessible tissue: Minghui63 flower, score: 52.791 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217061679 NA 1.55E-52 mr1016 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 1.73E-42 mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 1.93E-83 mr1018 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 3.34E-60 mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 3.44E-30 mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 5.04E-65 mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 2.85E-42 mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 1.47E-50 mr1079 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 7.08E-31 mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 4.68E-06 3.39E-48 mr1089 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 1.14E-09 9.59E-58 mr1093 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 4.93E-33 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 4.25E-81 mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 7.38E-70 mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 2.40E-12 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 1.28E-65 mr1178 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 2.22E-06 7.32E-50 mr1235 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 1.53E-37 mr1243 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 2.40E-26 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 1.22E-62 mr1390 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 2.10E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 7.05E-25 mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 4.03E-08 1.66E-38 mr1423 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 6.16E-10 mr1423 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 2.57E-06 5.11E-42 mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 3.54E-73 mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 4.55E-61 mr1490 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 1.26E-70 mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 1.17E-33 mr1546 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 2.52E-57 mr1599 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 3.58E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 2.07E-33 mr1733 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 4.34E-38 mr1780 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 2.29E-12 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 5.42E-75 mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 3.76E-42 mr1022_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 1.28E-77 mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 2.15E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 2.82E-61 mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 3.76E-60 mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 8.17E-06 2.43E-59 mr1089_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 3.57E-08 8.65E-68 mr1093_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 1.30E-36 mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 1.78E-93 mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 4.22E-37 mr1155_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 1.66E-93 mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 1.06E-65 mr1235_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 6.96E-50 mr1243_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 1.07E-14 mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 4.13E-45 mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 2.53E-40 mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 5.15E-19 mr1276_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 4.18E-74 mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 7.91E-36 mr1423_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 7.24E-45 mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 2.50E-79 mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 2.07E-75 mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 1.71E-73 mr1599_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 3.82E-07 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 2.00E-38 mr1780_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217061679 NA 2.38E-40 mr1805_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251