\
| Variant ID: vg0217025287 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 17025287 |
| Reference Allele: T | Alternative Allele: A,C |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGTCCTTATACCCGAAAATTGATATTGATGCTGTTGACGGCTCTGCAGACGGGACAAGTGAGGAGGCCGCCCTTGACCTCATCAGTGATGCGCAAAAGGC[T/A,C]
GCTGACAAGATAGCCGCTGATGTAGTTGAGAGATTCCAGGACAACGATCTTAAGCCGACTGGGTCTGATAATTCTGATGATGAAAGAACTGAATCTAATT
AATTAGATTCAGTTCTTTCATCATCAGAATTATCAGACCCAGTCGGCTTAAGATCGTTGTCCTGGAATCTCTCAACTACATCAGCGGCTATCTTGTCAGC[A/T,G]
GCCTTTTGCGCATCACTGATGAGGTCAAGGGCGGCCTCCTCACTTGTCCCGTCTGCAGAGCCGTCAACAGCATCAATATCAATTTTCGGGTATAAGGACT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.10% | 8.90% | 1.04% | 0.00% | NA |
| All Indica | 2759 | 96.40% | 3.50% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 76.20% | 20.80% | 3.04% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.00% | 7.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.00% | 1.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 78.50% | 17.10% | 4.43% | 0.00% | NA |
| Tropical Japonica | 504 | 86.50% | 12.50% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 47.30% | 49.80% | 2.90% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 4.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0217025287 | T -> A | LOC_Os02g28770.1 | synonymous_variant ; p.Ala457Ala; LOW | synonymous_codon | Average:35.928; most accessible tissue: Minghui63 flag leaf, score: 55.781 | N | N | N | N |
| vg0217025287 | T -> C | LOC_Os02g28770.1 | synonymous_variant ; p.Ala457Ala; LOW | N | Average:35.928; most accessible tissue: Minghui63 flag leaf, score: 55.781 | N | N | N | N |
| vg0217025287 | T -> C | LOC_Os02g28780.1 | downstream_gene_variant ; 414.0bp to feature; MODIFIER | N | Average:35.928; most accessible tissue: Minghui63 flag leaf, score: 55.781 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0217025287 | 4.65E-06 | NA | mr1093 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217025287 | 8.46E-06 | 8.46E-06 | mr1914 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217025287 | NA | 1.65E-06 | mr1187_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217025287 | NA | 3.30E-06 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217025287 | 4.66E-10 | NA | mr1317_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217025287 | 2.87E-07 | 2.87E-07 | mr1317_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217025287 | NA | 2.02E-06 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217025287 | NA | 2.05E-08 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217025287 | 9.21E-09 | NA | mr1897_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217025287 | 8.35E-07 | 8.35E-07 | mr1897_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217025287 | 2.19E-09 | NA | mr1914_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217025287 | 1.26E-09 | 1.26E-09 | mr1914_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217025287 | 1.97E-07 | NA | mr1927_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217025287 | 5.19E-07 | 5.19E-07 | mr1927_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |