\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217011720:

Variant ID: vg0217011720 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17011720
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


CTTCAAAATCTTCTCCTGCAAACTCAGACTCTCCGGGAACGTCAGAATCTAAAGAGAAAAGAGCAAAATCACCAAAACACCACATAAACAAGCATGAACA[G/A]
TACATGTGGATATTTTTAACATGTAGATCTCGATTTTAGAAAAATTTAGAGACTTGAACCAACTAAATCTGAGCTAAGATGAATTAGTTATGAATTTTTA

Reverse complement sequence

TAAAAATTCATAACTAATTCATCTTAGCTCAGATTTAGTTGGTTCAAGTCTCTAAATTTTTCTAAAATCGAGATCTACATGTTAAAAATATCCACATGTA[C/T]
TGTTCATGCTTGTTTATGTGGTGTTTTGGTGATTTTGCTCTTTTCTCTTTAGATTCTGACGTTCCCGGAGAGTCTGAGTTTGCAGGAGAAGATTTTGAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.90% 16.10% 9.78% 0.21% NA
All Indica  2759 56.10% 27.20% 16.35% 0.36% NA
All Japonica  1512 99.40% 0.40% 0.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 60.30% 18.20% 20.50% 1.01% NA
Indica II  465 54.40% 21.30% 24.09% 0.22% NA
Indica III  913 58.10% 34.60% 7.23% 0.11% NA
Indica Intermediate  786 51.70% 28.90% 19.21% 0.25% NA
Temperate Japonica  767 99.30% 0.40% 0.26% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 5.60% 8.89% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217011720 G -> A LOC_Os02g28750.1 upstream_gene_variant ; 667.0bp to feature; MODIFIER silent_mutation Average:22.674; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0217011720 G -> A LOC_Os02g28730-LOC_Os02g28750 intergenic_region ; MODIFIER silent_mutation Average:22.674; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0217011720 G -> DEL N N silent_mutation Average:22.674; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217011720 NA 7.08E-07 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217011720 NA 3.14E-10 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217011720 NA 2.81E-08 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217011720 NA 6.88E-08 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217011720 NA 7.01E-07 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217011720 NA 4.50E-08 mr1253 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217011720 NA 1.75E-07 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217011720 NA 3.68E-09 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217011720 NA 3.18E-06 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217011720 NA 2.60E-07 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217011720 NA 4.87E-09 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217011720 NA 1.38E-12 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217011720 NA 2.76E-13 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217011720 3.80E-07 3.80E-07 mr1196_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217011720 4.29E-07 4.29E-07 mr1196_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217011720 NA 6.55E-10 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217011720 NA 3.64E-07 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217011720 NA 2.39E-09 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217011720 NA 7.12E-11 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217011720 NA 6.82E-10 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217011720 NA 6.53E-08 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251