RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0216956622:

Variant ID: vg0216956622 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 16956622
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.06, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:

GGTTTTATAAACTATAACACATATATGTACAATTTGTGAACAATGTTACTAATATTTTGTCAGATGAAGAAATAACAAAAAAAAGTTTTAGATCTTGATG[A/G]
GTTATACTATTTTGTTGTTGATGACTTTTTCAATTGAAATCATTTAGTATTTGAAAATATTGTTTGAAGTTGTCATATTTTCAAATTCAAATTCAAAATG

Reverse complement sequence

CATTTTGAATTTGAATTTGAAAATATGACAACTTCAAACAATATTTTCAAATACTAAATGATTTCAATTGAAAAAGTCATCAACAACAAAATAGTATAAC[T/C]
CATCAAGATCTAAAACTTTTTTTTGTTATTTCTTCATCTGACAAAATATTAGTAACATTGTTCACAAATTGTACATATATGTGTTATAGTTTATAAAACC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.60%	28.10%	0.30%	0.00%	NA
All Indica	2759	52.40%	47.20%	0.43%	0.00%	NA
All Japonica	1512	99.30%	0.70%	0.00%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	58.80%	40.80%	0.34%	0.00%	NA
Indica II	465	49.50%	49.90%	0.65%	0.00%	NA
Indica III	913	54.50%	45.20%	0.22%	0.00%	NA
Indica Intermediate	786	46.80%	52.50%	0.64%	0.00%	NA
Temperate Japonica	767	99.20%	0.80%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	15.60%	2.22%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0216956622	A -> G	LOC_Os02g28660.1	upstream_gene_variant ; 2875.0bp to feature; MODIFIER	silent_mutation	Average:19.494; most accessible tissue: Minghui63 young leaf, score: 26.082	N	N	N	N
vg0216956622	A -> G	LOC_Os02g28650.1	downstream_gene_variant ; 3710.0bp to feature; MODIFIER	silent_mutation	Average:19.494; most accessible tissue: Minghui63 young leaf, score: 26.082	N	N	N	N
vg0216956622	A -> G	LOC_Os02g28650-LOC_Os02g28660	intergenic_region ; MODIFIER	silent_mutation	Average:19.494; most accessible tissue: Minghui63 young leaf, score: 26.082	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0216956622	1.65E-17	4.84E-44	mr1089	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216956622	1.39E-19	2.22E-24	mr1089	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216956622	1.54E-14	NA	mr1093	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216956622	7.39E-16	3.41E-21	mr1093	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216956622	NA	6.21E-08	mr1106	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216956622	NA	6.50E-08	mr1106	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216956622	1.62E-30	1.36E-85	mr1109	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216956622	5.50E-27	6.19E-44	mr1109	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216956622	9.22E-26	8.52E-66	mr1129	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216956622	8.28E-24	2.18E-40	mr1129	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 90 entries

Previous1 2 3 4 5…9Next

Search for Variation information by Variation ID:

Detailed information for vg0216956622:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact