\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216929727:

Variant ID: vg0216929727 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 16929727
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAAATAAAATTGCATGCTAATTATAAAATACTCCCTCCGTCTCAAAATAAGTGCAGTTTTGCACTATTCACGTTCAACGTTTGATCGTTCGTCTTATTT[G/A]
AAAATTTTTTATGATTAGTATTTTTATTGCTATTAGATGATAAAACATGAATAGTACTTTTTATATATATGTGACTAAATATTTTCAATTTTTTCACAAA

Reverse complement sequence

TTTGTGAAAAAATTGAAAATATTTAGTCACATATATATAAAAAGTACTATTCATGTTTTATCATCTAATAGCAATAAAAATACTAATCATAAAAAATTTT[C/T]
AAATAAGACGAACGATCAAACGTTGAACGTGAATAGTGCAAAACTGCACTTATTTTGAGACGGAGGGAGTATTTTATAATTAGCATGCAATTTTATTTGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.10% 2.80% 0.13% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 90.90% 8.70% 0.33% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 85.50% 13.80% 0.65% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 89.20% 10.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216929727 G -> A LOC_Os02g28610.1 upstream_gene_variant ; 1240.0bp to feature; MODIFIER silent_mutation Average:54.007; most accessible tissue: Callus, score: 76.34 N N N N
vg0216929727 G -> A LOC_Os02g28600.1 downstream_gene_variant ; 4352.0bp to feature; MODIFIER silent_mutation Average:54.007; most accessible tissue: Callus, score: 76.34 N N N N
vg0216929727 G -> A LOC_Os02g28620.1 downstream_gene_variant ; 4747.0bp to feature; MODIFIER silent_mutation Average:54.007; most accessible tissue: Callus, score: 76.34 N N N N
vg0216929727 G -> A LOC_Os02g28600-LOC_Os02g28610 intergenic_region ; MODIFIER silent_mutation Average:54.007; most accessible tissue: Callus, score: 76.34 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216929727 1.46E-08 1.62E-09 mr1897 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216929727 NA 3.13E-07 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216929727 2.12E-13 2.12E-13 mr1317_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216929727 NA 7.22E-07 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216929727 2.02E-07 2.02E-07 mr1608_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216929727 4.43E-14 4.43E-14 mr1897_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216929727 5.37E-14 5.37E-14 mr1914_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216929727 7.18E-11 7.18E-11 mr1927_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251