\
| Variant ID: vg0216929727 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 16929727 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCAAATAAAATTGCATGCTAATTATAAAATACTCCCTCCGTCTCAAAATAAGTGCAGTTTTGCACTATTCACGTTCAACGTTTGATCGTTCGTCTTATTT[G/A]
AAAATTTTTTATGATTAGTATTTTTATTGCTATTAGATGATAAAACATGAATAGTACTTTTTATATATATGTGACTAAATATTTTCAATTTTTTCACAAA
TTTGTGAAAAAATTGAAAATATTTAGTCACATATATATAAAAAGTACTATTCATGTTTTATCATCTAATAGCAATAAAAATACTAATCATAAAAAATTTT[C/T]
AAATAAGACGAACGATCAAACGTTGAACGTGAATAGTGCAAAACTGCACTTATTTTGAGACGGAGGGAGTATTTTATAATTAGCATGCAATTTTATTTGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.10% | 2.80% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 90.90% | 8.70% | 0.33% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 85.50% | 13.80% | 0.65% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 89.20% | 10.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0216929727 | G -> A | LOC_Os02g28610.1 | upstream_gene_variant ; 1240.0bp to feature; MODIFIER | silent_mutation | Average:54.007; most accessible tissue: Callus, score: 76.34 | N | N | N | N |
| vg0216929727 | G -> A | LOC_Os02g28600.1 | downstream_gene_variant ; 4352.0bp to feature; MODIFIER | silent_mutation | Average:54.007; most accessible tissue: Callus, score: 76.34 | N | N | N | N |
| vg0216929727 | G -> A | LOC_Os02g28620.1 | downstream_gene_variant ; 4747.0bp to feature; MODIFIER | silent_mutation | Average:54.007; most accessible tissue: Callus, score: 76.34 | N | N | N | N |
| vg0216929727 | G -> A | LOC_Os02g28600-LOC_Os02g28610 | intergenic_region ; MODIFIER | silent_mutation | Average:54.007; most accessible tissue: Callus, score: 76.34 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0216929727 | 1.46E-08 | 1.62E-09 | mr1897 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216929727 | NA | 3.13E-07 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216929727 | 2.12E-13 | 2.12E-13 | mr1317_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216929727 | NA | 7.22E-07 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216929727 | 2.02E-07 | 2.02E-07 | mr1608_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216929727 | 4.43E-14 | 4.43E-14 | mr1897_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216929727 | 5.37E-14 | 5.37E-14 | mr1914_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216929727 | 7.18E-11 | 7.18E-11 | mr1927_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |