| Variant ID: vg0216865447 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 16865447 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.01, others allele: 0.00, population size: 72. )
ACATTAAATGCATAGATATCAGATTCTAGGATTGATGTTGGTTAATGCTCACCGCTCCGGTGTTTGTTAATTAATTAATATTAAATGGTGGGCCATGGGT[G/T]
CATGGTTTTGATGGTCGCGCCCAGAGTAATTAAGGACCGGTTCGCGGGAAACCCTGGAAGAATTCCTCGTACTTACCACAAGCCAGCGTGGGCAACGGCT
AGCCGTTGCCCACGCTGGCTTGTGGTAAGTACGAGGAATTCTTCCAGGGTTTCCCGCGAACCGGTCCTTAATTACTCTGGGCGCGACCATCAAAACCATG[C/A]
ACCCATGGCCCACCATTTAATATTAATTAATTAACAAACACCGGAGCGGTGAGCATTAACCAACATCAATCCTAGAATCTGATATCTATGCATTTAATGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.70% | 26.90% | 1.82% | 0.55% | NA |
| All Indica | 2759 | 91.80% | 4.60% | 2.97% | 0.65% | NA |
| All Japonica | 1512 | 25.50% | 73.90% | 0.13% | 0.53% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.10% | 1.50% | 0.00% | 1.34% | NA |
| Indica II | 465 | 88.20% | 9.20% | 1.72% | 0.86% | NA |
| Indica III | 913 | 87.60% | 5.60% | 6.35% | 0.44% | NA |
| Indica Intermediate | 786 | 94.70% | 3.10% | 2.04% | 0.25% | NA |
| Temperate Japonica | 767 | 4.30% | 95.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 59.70% | 38.30% | 0.40% | 1.59% | NA |
| Japonica Intermediate | 241 | 21.20% | 78.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 27.80% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0216865447 | G -> T | LOC_Os02g28500.1 | downstream_gene_variant ; 4612.0bp to feature; MODIFIER | silent_mutation | Average:36.901; most accessible tissue: Minghui63 flag leaf, score: 74.161 | N | N | N | N |
| vg0216865447 | G -> T | LOC_Os02g28510.1 | downstream_gene_variant ; 698.0bp to feature; MODIFIER | silent_mutation | Average:36.901; most accessible tissue: Minghui63 flag leaf, score: 74.161 | N | N | N | N |
| vg0216865447 | G -> T | LOC_Os02g28510-LOC_Os02g28520 | intergenic_region ; MODIFIER | silent_mutation | Average:36.901; most accessible tissue: Minghui63 flag leaf, score: 74.161 | N | N | N | N |
| vg0216865447 | G -> DEL | N | N | silent_mutation | Average:36.901; most accessible tissue: Minghui63 flag leaf, score: 74.161 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0216865447 | NA | 1.84E-36 | mr1017 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216865447 | NA | 7.61E-07 | mr1018 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216865447 | NA | 1.60E-11 | mr1023 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216865447 | NA | 3.57E-36 | mr1055 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216865447 | NA | 1.06E-08 | mr1076 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216865447 | NA | 8.16E-12 | mr1079 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216865447 | 1.73E-06 | 1.91E-13 | mr1082 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216865447 | NA | 3.36E-07 | mr1083 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216865447 | NA | 7.29E-07 | mr1085 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216865447 | NA | 1.16E-08 | mr1086 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/