Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216851136:

Variant ID: vg0216851136 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 16851136
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.03, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:


CCTAGCCGAGCCGGGCCGCCGCCGCCCTTCCAAATTCGTTCATCCCTTTCTCGATCCGGTGAAATTGATAGAGGGAAAATGATCCCCGAGATTCACTCTA[C/A]
CTTTTCTCTTTTTGAATCGTCGGCTAAAATCGTTTGGAAATCCGTGGATTCGACCTCGAATCGGATTCGTCTCTCTCCCTGAACCCTAATCTTTCCTTCT

Reverse complement sequence

AGAAGGAAAGATTAGGGTTCAGGGAGAGAGACGAATCCGATTCGAGGTCGAATCCACGGATTTCCAAACGATTTTAGCCGACGATTCAAAAAGAGAAAAG[G/T]
TAGAGTGAATCTCGGGGATCATTTTCCCTCTATCAATTTCACCGGATCGAGAAAGGGATGAACGAATTTGGAAGGGCGGCGGCGGCCCGGCTCGGCTAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.70% 13.60% 0.08% 1.61% NA
All Indica  2759 79.10% 18.10% 0.11% 2.75% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 52.40% 47.60% 0.00% 0.00% NA
Indica I  595 78.50% 21.20% 0.34% 0.00% NA
Indica II  465 71.60% 27.10% 0.00% 1.29% NA
Indica III  913 80.70% 12.80% 0.11% 6.35% NA
Indica Intermediate  786 81.90% 16.50% 0.00% 1.53% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 92.20% 6.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216851136 C -> A LOC_Os02g28500.1 upstream_gene_variant ; 3360.0bp to feature; MODIFIER silent_mutation Average:57.768; most accessible tissue: Zhenshan97 flag leaf, score: 76.642 N N N N
vg0216851136 C -> A LOC_Os02g28490.1 downstream_gene_variant ; 781.0bp to feature; MODIFIER silent_mutation Average:57.768; most accessible tissue: Zhenshan97 flag leaf, score: 76.642 N N N N
vg0216851136 C -> A LOC_Os02g28490-LOC_Os02g28500 intergenic_region ; MODIFIER silent_mutation Average:57.768; most accessible tissue: Zhenshan97 flag leaf, score: 76.642 N N N N
vg0216851136 C -> DEL N N silent_mutation Average:57.768; most accessible tissue: Zhenshan97 flag leaf, score: 76.642 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216851136 NA 2.58E-09 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 4.85E-06 NA mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 4.46E-06 7.43E-11 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 NA 3.43E-06 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 NA 3.99E-06 mr1253 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 NA 7.86E-07 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 NA 3.06E-06 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 1.51E-19 8.68E-36 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 1.39E-19 2.85E-38 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 3.77E-06 NA mr1350 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 7.60E-09 1.97E-11 mr1350 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 NA 7.48E-06 mr1409 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 NA 3.96E-06 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 NA 1.67E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 NA 1.59E-08 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 5.16E-06 1.74E-10 mr1585 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 NA 7.24E-08 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 NA 5.03E-09 mr1608 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 NA 3.80E-06 mr1608 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 1.57E-09 5.16E-11 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 1.48E-09 2.64E-11 mr1610 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 NA 2.62E-07 mr1649 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 2.01E-10 6.85E-17 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 2.75E-34 4.83E-107 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 7.11E-34 5.44E-81 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 1.93E-08 1.49E-18 mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 3.67E-08 1.63E-11 mr1897 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 1.24E-13 6.75E-18 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 1.15E-11 3.77E-17 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 6.52E-14 2.15E-19 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 3.13E-12 1.36E-16 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 NA 2.61E-11 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 9.44E-10 NA mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 1.07E-09 1.15E-15 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 1.33E-06 NA mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 1.27E-06 2.16E-08 mr1248_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 1.80E-06 NA mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 1.54E-06 3.28E-09 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 2.30E-06 NA mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 NA 6.17E-09 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 4.51E-08 NA mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 3.41E-07 5.15E-12 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 6.19E-07 NA mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 1.92E-07 2.29E-13 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 1.03E-24 1.95E-47 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 1.63E-27 3.26E-51 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 NA 9.77E-06 mr1377_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 4.81E-06 2.74E-11 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 NA 7.79E-06 mr1409_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 1.68E-06 NA mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 1.37E-06 2.67E-09 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 NA 1.31E-08 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 NA 1.10E-07 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 4.97E-09 1.58E-10 mr1585_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 NA 1.06E-07 mr1603_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 3.08E-14 2.66E-26 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 1.91E-13 3.29E-21 mr1608_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 4.03E-16 6.71E-30 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 9.21E-16 2.57E-26 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 NA 6.06E-07 mr1649_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 2.12E-21 7.94E-43 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 1.49E-21 9.53E-34 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 9.19E-49 2.00E-140 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 1.25E-45 4.93E-109 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 3.37E-21 1.15E-41 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 9.58E-23 2.81E-37 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 9.22E-24 6.74E-50 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 1.02E-24 3.52E-53 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 1.35E-26 7.35E-53 mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216851136 2.97E-27 8.46E-50 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251