\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216814133:

Variant ID: vg0216814133 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 16814133
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATCTATTATCTATTCTATTCTATTCTATTATATACTAAAAGTCCATTAAACTTTCTACAAACGCTCCCAAGCCACCATGTGGCACTCCTACAAACGCTC[A/G]
TAGGCTGCCACGTGGCACAGTCAAATCTCACCGTCGATTTTCATTTAAATTGGTAGACCCATTATTTTATACCGTTAGATTAGACCTGTACATGCCGTCG

Reverse complement sequence

CGACGGCATGTACAGGTCTAATCTAACGGTATAAAATAATGGGTCTACCAATTTAAATGAAAATCGACGGTGAGATTTGACTGTGCCACGTGGCAGCCTA[T/C]
GAGCGTTTGTAGGAGTGCCACATGGTGGCTTGGGAGCGTTTGTAGAAAGTTTAATGGACTTTTAGTATATAATAGAATAGAATAGAATAGATAATAGATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.90% 1.40% 1.12% 1.57% NA
All Indica  2759 93.00% 2.40% 1.92% 2.68% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 90.60% 5.70% 3.70% 0.00% NA
Indica II  465 93.50% 1.70% 3.44% 1.29% NA
Indica III  913 93.80% 0.00% 0.11% 6.13% NA
Indica Intermediate  786 93.60% 3.10% 1.78% 1.53% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216814133 A -> G LOC_Os02g28420.1 upstream_gene_variant ; 3822.0bp to feature; MODIFIER silent_mutation Average:71.339; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N
vg0216814133 A -> G LOC_Os02g28430.1 upstream_gene_variant ; 2421.0bp to feature; MODIFIER silent_mutation Average:71.339; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N
vg0216814133 A -> G LOC_Os02g28430-LOC_Os02g28450 intergenic_region ; MODIFIER silent_mutation Average:71.339; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N
vg0216814133 A -> DEL N N silent_mutation Average:71.339; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216814133 NA 5.89E-06 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216814133 9.04E-06 1.37E-06 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216814133 2.60E-06 2.15E-07 mr1253 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216814133 9.64E-06 1.22E-06 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216814133 NA 2.24E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216814133 NA 1.99E-09 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216814133 NA 2.91E-08 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251