\
| Variant ID: vg0216814133 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 16814133 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TATCTATTATCTATTCTATTCTATTCTATTATATACTAAAAGTCCATTAAACTTTCTACAAACGCTCCCAAGCCACCATGTGGCACTCCTACAAACGCTC[A/G]
TAGGCTGCCACGTGGCACAGTCAAATCTCACCGTCGATTTTCATTTAAATTGGTAGACCCATTATTTTATACCGTTAGATTAGACCTGTACATGCCGTCG
CGACGGCATGTACAGGTCTAATCTAACGGTATAAAATAATGGGTCTACCAATTTAAATGAAAATCGACGGTGAGATTTGACTGTGCCACGTGGCAGCCTA[T/C]
GAGCGTTTGTAGGAGTGCCACATGGTGGCTTGGGAGCGTTTGTAGAAAGTTTAATGGACTTTTAGTATATAATAGAATAGAATAGAATAGATAATAGATA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.90% | 1.40% | 1.12% | 1.57% | NA |
| All Indica | 2759 | 93.00% | 2.40% | 1.92% | 2.68% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 90.60% | 5.70% | 3.70% | 0.00% | NA |
| Indica II | 465 | 93.50% | 1.70% | 3.44% | 1.29% | NA |
| Indica III | 913 | 93.80% | 0.00% | 0.11% | 6.13% | NA |
| Indica Intermediate | 786 | 93.60% | 3.10% | 1.78% | 1.53% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0216814133 | A -> G | LOC_Os02g28420.1 | upstream_gene_variant ; 3822.0bp to feature; MODIFIER | silent_mutation | Average:71.339; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| vg0216814133 | A -> G | LOC_Os02g28430.1 | upstream_gene_variant ; 2421.0bp to feature; MODIFIER | silent_mutation | Average:71.339; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| vg0216814133 | A -> G | LOC_Os02g28430-LOC_Os02g28450 | intergenic_region ; MODIFIER | silent_mutation | Average:71.339; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| vg0216814133 | A -> DEL | N | N | silent_mutation | Average:71.339; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0216814133 | NA | 5.89E-06 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216814133 | 9.04E-06 | 1.37E-06 | mr1109 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216814133 | 2.60E-06 | 2.15E-07 | mr1253 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216814133 | 9.64E-06 | 1.22E-06 | mr1255 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216814133 | NA | 2.24E-07 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216814133 | NA | 1.99E-09 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216814133 | NA | 2.91E-08 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |