\
| Variant ID: vg0216804396 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 16804396 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 68. )
GACTTCTTTTTATATTTCCAAAAGAAAACGAATTTAAAATCGACTCAAACAAGGATATGTATTTCCAAAAACAAACAAACTTAAAAACCGACTCAAATAC[G/A]
AATGACGTACCAAAATACAGGCAAAAACATCTTTAATTTTTATAATAGTAGAGATGATGTCAAGAAAAAGTATGGTACAAAATTAAATATCTACACAAAA
TTTTGTGTAGATATTTAATTTTGTACCATACTTTTTCTTGACATCATCTCTACTATTATAAAAATTAAAGATGTTTTTGCCTGTATTTTGGTACGTCATT[C/T]
GTATTTGAGTCGGTTTTTAAGTTTGTTTGTTTTTGGAAATACATATCCTTGTTTGAGTCGATTTTAAATTCGTTTTCTTTTGGAAATATAAAAAGAAGTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.30% | 31.00% | 0.06% | 1.59% | NA |
| All Indica | 2759 | 48.90% | 48.30% | 0.07% | 2.72% | NA |
| All Japonica | 1512 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 58.70% | 41.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 48.20% | 50.50% | 0.00% | 1.29% | NA |
| Indica III | 913 | 45.50% | 48.10% | 0.11% | 6.35% | NA |
| Indica Intermediate | 786 | 45.90% | 52.50% | 0.13% | 1.40% | NA |
| Temperate Japonica | 767 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 10.40% | 89.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 28.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0216804396 | G -> A | LOC_Os02g28410.1 | upstream_gene_variant ; 1545.0bp to feature; MODIFIER | silent_mutation | Average:20.856; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg0216804396 | G -> A | LOC_Os02g28420.1 | downstream_gene_variant ; 3441.0bp to feature; MODIFIER | silent_mutation | Average:20.856; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg0216804396 | G -> A | LOC_Os02g28400-LOC_Os02g28410 | intergenic_region ; MODIFIER | silent_mutation | Average:20.856; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg0216804396 | G -> DEL | N | N | silent_mutation | Average:20.856; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0216804396 | 4.22E-23 | 7.26E-58 | mr1089 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 7.69E-22 | 4.05E-26 | mr1089 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 6.72E-19 | 2.37E-51 | mr1093 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 2.13E-17 | 1.22E-22 | mr1093 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | NA | 9.96E-06 | mr1106 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | NA | 2.41E-07 | mr1106 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 2.21E-36 | 4.90E-92 | mr1109 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 5.90E-32 | 4.82E-48 | mr1109 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 2.95E-33 | 2.91E-86 | mr1129 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 3.41E-27 | 1.24E-43 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 6.30E-06 | 6.29E-06 | mr1198 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 2.23E-23 | 8.50E-55 | mr1235 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 3.24E-20 | 1.43E-24 | mr1235 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 8.24E-09 | 2.26E-14 | mr1236 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 2.02E-09 | 8.13E-16 | mr1236 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 2.30E-13 | 1.42E-37 | mr1243 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 1.13E-11 | 1.80E-13 | mr1243 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 2.11E-27 | 1.60E-68 | mr1251 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 1.62E-20 | 5.89E-33 | mr1251 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 2.95E-24 | 1.05E-50 | mr1253 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 6.87E-19 | 8.42E-23 | mr1253 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 1.67E-32 | 4.50E-71 | mr1255 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 6.52E-23 | 3.99E-34 | mr1255 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 3.60E-36 | 5.73E-90 | mr1257 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 3.02E-28 | 7.04E-43 | mr1257 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | NA | 8.56E-14 | mr1317 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | NA | 5.50E-06 | mr1317 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | NA | 7.71E-07 | mr1350 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 9.42E-07 | 8.86E-10 | mr1377 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 1.40E-23 | 2.10E-52 | mr1423 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 5.21E-21 | 2.86E-27 | mr1423 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 8.88E-34 | 2.85E-77 | mr1435 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 6.70E-27 | 5.09E-39 | mr1435 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | NA | 8.84E-06 | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | NA | 1.72E-06 | mr1548 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 3.40E-27 | 4.16E-70 | mr1599 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 7.63E-24 | 4.02E-32 | mr1599 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | NA | 2.34E-10 | mr1610 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 6.18E-07 | NA | mr1855 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | NA | 9.02E-15 | mr1855 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | NA | 5.05E-06 | mr1901 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | NA | 7.34E-09 | mr1901 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | NA | 2.10E-12 | mr1914 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | NA | 7.14E-06 | mr1914 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | NA | 2.26E-11 | mr1927 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 2.48E-22 | 1.44E-60 | mr1089_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 2.54E-23 | 6.26E-34 | mr1089_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 4.83E-17 | NA | mr1093_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 1.62E-16 | 4.81E-26 | mr1093_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 4.02E-31 | 4.23E-91 | mr1109_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 2.33E-29 | 8.17E-55 | mr1109_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 5.43E-35 | 1.56E-91 | mr1129_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 1.04E-33 | 3.87E-62 | mr1129_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | NA | 1.31E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 8.70E-06 | 4.28E-07 | mr1229_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 4.86E-16 | NA | mr1235_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 8.65E-15 | 1.53E-24 | mr1235_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 2.00E-09 | 2.77E-17 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 1.46E-10 | 6.23E-18 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 3.37E-09 | NA | mr1243_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 1.37E-08 | 1.70E-13 | mr1243_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 4.31E-11 | 1.92E-21 | mr1248_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 4.87E-12 | 4.91E-18 | mr1248_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 4.36E-24 | 4.08E-64 | mr1251_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 7.68E-25 | 2.20E-41 | mr1251_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 1.62E-23 | 1.25E-54 | mr1253_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 2.80E-19 | 1.32E-25 | mr1253_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 2.17E-30 | 6.29E-71 | mr1255_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 2.06E-26 | 1.34E-46 | mr1255_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 2.38E-34 | 8.02E-97 | mr1257_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 2.90E-28 | 2.59E-57 | mr1257_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | NA | 3.52E-15 | mr1317_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | NA | 2.62E-10 | mr1317_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 3.44E-11 | 8.04E-27 | mr1377_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 3.67E-09 | 2.02E-17 | mr1377_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 7.56E-18 | 3.66E-38 | mr1423_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 6.47E-17 | 9.24E-24 | mr1423_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 5.14E-24 | 4.06E-64 | mr1435_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 9.02E-25 | 2.64E-41 | mr1435_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 6.54E-06 | 7.12E-09 | mr1597_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 6.80E-06 | 1.10E-07 | mr1597_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 1.06E-24 | 5.24E-66 | mr1599_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 1.47E-23 | 5.18E-38 | mr1599_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | NA | 5.06E-14 | mr1610_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | NA | 5.01E-08 | mr1610_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | NA | 1.88E-07 | mr1818_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 2.45E-12 | NA | mr1855_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 3.11E-10 | 3.40E-20 | mr1855_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | NA | 1.69E-06 | mr1863_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | NA | 4.24E-06 | mr1863_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 2.69E-06 | 5.11E-08 | mr1880_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | NA | 4.27E-08 | mr1897_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 3.89E-06 | NA | mr1907_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 9.36E-06 | NA | mr1907_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | 2.11E-06 | 7.24E-17 | mr1914_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | NA | 3.19E-13 | mr1914_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | NA | 1.27E-16 | mr1927_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216804396 | NA | 2.60E-10 | mr1927_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |