| Variant ID: vg0216784769 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 16784769 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, C: 0.10, others allele: 0.00, population size: 62. )
ACGAACTCTAGAGGCAGTCGTGAATCTCGACGGATGCACGATCAGCCCAAGCACGAGGGTATTTGTTCCTGCAAGCAATCGAGAACCAGCAAGAACAAGA[T/C]
GAACAAGCAAATAAATTTGCAAATCAAAGATGTTGGATTGAATCAATAGAAGTAACAAGTGGGGTTCAATAACAAGCAATCTAGCGATCTAATCGATCAC
GTGATCGATTAGATCGCTAGATTGCTTGTTATTGAACCCCACTTGTTACTTCTATTGATTCAATCCAACATCTTTGATTTGCAAATTTATTTGCTTGTTC[A/G]
TCTTGTTCTTGCTGGTTCTCGATTGCTTGCAGGAACAAATACCCTCGTGCTTGGGCTGATCGTGCATCCGTCGAGATTCACGACTGCCTCTAGAGTTCGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.70% | 28.30% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 93.00% | 7.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 26.30% | 73.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 89.70% | 10.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 88.10% | 11.80% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.70% | 4.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 4.40% | 95.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 61.90% | 38.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 21.20% | 78.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 27.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0216784769 | T -> C | LOC_Os02g28400.1 | intron_variant ; MODIFIER | silent_mutation | Average:44.564; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0216784769 | NA | 1.04E-34 | mr1017 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216784769 | NA | 5.60E-35 | mr1055 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216784769 | NA | 1.92E-09 | mr1082 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216784769 | 2.44E-09 | 4.32E-51 | mr1089 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216784769 | NA | 3.20E-08 | mr1089 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216784769 | NA | 1.69E-12 | mr1089 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216784769 | 5.07E-14 | 3.42E-64 | mr1093 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216784769 | 1.80E-06 | 4.64E-13 | mr1093 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216784769 | 3.32E-07 | 3.08E-18 | mr1093 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216784769 | NA | 9.98E-07 | mr1109 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/