| Variant ID: vg0216767403 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 16767403 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 107. )
TGGCGGCATTTTCTTTGTTTCTGGCCATCATCGCTTGCCCTTGTTGCCCTGTCTTGTAAGCAACGAACTCGTCCCAATGATCCCTTAGCTTTTGGAATAC[G/A]
TCGAAGTTCGGTGTTAGTCCCTTCAAGATGTATTTCTTGTAGAGATCTCCCTTGAAGCTCTGGAACTGTTCTGCTATTTTCTTCAGAGTCCACTGTTTCA
TGAAACAGTGGACTCTGAAGAAAATAGCAGAACAGTTCCAGAGCTTCAAGGGAGATCTCTACAAGAAATACATCTTGAAGGGACTAACACCGAACTTCGA[C/T]
GTATTCCAAAAGCTAAGGGATCATTGGGACGAGTTCGTTGCTTACAAGACAGGGCAACAAGGGCAAGCGATGATGGCCAGAAACAAAGAAAATGCCGCCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.00% | 2.50% | 5.37% | 62.12% | NA |
| All Indica | 2759 | 9.50% | 3.00% | 6.27% | 81.19% | NA |
| All Japonica | 1512 | 74.10% | 1.50% | 2.25% | 22.09% | NA |
| Aus | 269 | 1.10% | 3.70% | 7.43% | 87.73% | NA |
| Indica I | 595 | 5.70% | 2.40% | 5.04% | 86.89% | NA |
| Indica II | 465 | 11.60% | 3.40% | 7.53% | 77.42% | NA |
| Indica III | 913 | 12.70% | 3.60% | 6.57% | 77.11% | NA |
| Indica Intermediate | 786 | 7.50% | 2.50% | 6.11% | 83.84% | NA |
| Temperate Japonica | 767 | 95.70% | 0.40% | 0.00% | 3.91% | NA |
| Tropical Japonica | 504 | 39.10% | 3.00% | 5.75% | 52.18% | NA |
| Japonica Intermediate | 241 | 78.80% | 2.10% | 2.07% | 17.01% | NA |
| VI/Aromatic | 96 | 3.10% | 2.10% | 22.92% | 71.88% | NA |
| Intermediate | 90 | 28.90% | 2.20% | 5.56% | 63.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0216767403 | G -> A | LOC_Os02g28370.1 | synonymous_variant ; p.Asp195Asp; LOW | synonymous_codon | Average:41.458; most accessible tissue: Minghui63 flag leaf, score: 70.17 | N | N | N | N |
| vg0216767403 | G -> DEL | LOC_Os02g28370.1 | N | frameshift_variant | Average:41.458; most accessible tissue: Minghui63 flag leaf, score: 70.17 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0216767403 | NA | 1.91E-46 | mr1016 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216767403 | NA | 1.75E-37 | mr1017 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216767403 | NA | 6.29E-37 | mr1055 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216767403 | NA | 2.45E-08 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216767403 | 5.61E-10 | 3.38E-54 | mr1089 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216767403 | 2.36E-07 | 1.62E-11 | mr1089 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216767403 | NA | 8.49E-12 | mr1089 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216767403 | 1.10E-14 | 4.43E-67 | mr1093 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216767403 | 1.32E-10 | 4.24E-19 | mr1093 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216767403 | 4.63E-06 | 1.09E-16 | mr1093 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/